39 resultados para Cancer detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

We characterized the functional consequences of intravesical bacillus Calmette-Guérin on the molecular mechanism of the AKT/mTOR signaling pathway in nonmuscle invasive bladder cancer. To our knowledge this has not been reported previously. At age 7 weeks female Fischer 344 rats received 1.5 mg/kg MNU intravesically every other week for 6 weeks. They were randomized at 10 per group to MNU (0.2 ml vehicle), bacillus Calmette-Guérin (10(6) cfu Connaught strain), rapamycin (15 μg/ml) and bacillus Calmette-Guérin plus simultaneous rapamycin, each intravesically for 6 weeks. At week 15 the bladders were collected for histopathology, immunohistochemistry and immunoblot to determine p-AKT, Rictor, Raptor, p-4E-BP1, p-p70S6K1, p-AMPK-α, p-mTOR and p-p53. Papillary carcinoma (pTa) and high grade intraepithelial neoplasia (pTis) predominated in the MNU group while normal urothelium, papillary and flat hyperplasia were more common in treated groups. Nonmuscle invasive bladder cancer treated with bacillus Calmette-Guérin showed suppression of p70S6K1 but not 4E-BP1 phosphorylation. This suggests that 4E-BP1 is regulated differently than p70S6K1, escaping the bacillus Calmette-Guérin action that occurs in a mTOR independent manner. The association of bacillus Calmette-Guérin with rapamycin but not rapamycin monotherapy affected p70S6K1 and 4E-BP1 phosphorylation with no features of in situ carcinoma (pTis). The activation status of p70S6K1 and 4E-BP1 might be used to stratify patients who could benefit from targeting such molecular elements with multitarget/multidrug intravesical therapy. In the future 4E-BP1 might be a worthwhile new target for bacillus Calmette-Guérin refractory nonmuscle invasive bladder cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose. To understand the role of polymorphisms in the LEP (rs7799039 and rs2167270) and LEPR (rs1137101 and rs1137100) genes in DTC susceptibility and their effect on leptin levels. Methods. We studied 153 patients with DTC and 234 controls through TaqMan SNP Genotyping and ELISA, comparing these data to the clinicopathological data of patients with DTC. Results. Patients with AA genotype of rs7799039 had higher levels of serum leptin (9.22 ± 0.98 ng/mL) than those with AG genotype (10.07 ± 0.60 ng/mL; P = 0.005). Individuals with AG genotype of rs2167270 also produced higher serum leptin levels (10.05 ± 0.59 ng/mL) than the subjects with GG genotype (9.52 ± 0.79 ng/mL; P < 0.05). A multivariate logistic regression adjusted for gender, age, and BMI showed that the AG genotype of rs7799039 was an independent risk for DTC (OR, 11.689; P = 0.0183; 95% CI, 1.516-90.119). Similarly, AG and GG genotypes of rs1137101 increased the susceptibility to DTC (OR, 3.747; P = 0.027; 95% CI, 1.161-12.092 and OR, 5.437; P = 0.013; 95% CI, 1.426-20.729). Conclusions. We demonstrated that rs7799039 and rs2167270 polymorphisms modify the serum leptin concentrations in patients with DTC. Furthermore, polymorphisms rs7799039 and rs1137101 increase the risk of DTC development, although they do not correlate with tumor aggressiveness.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Phosphatases have long been regarded as tumor suppressors, however there is emerging evidence for a tumor initiating role for some phosphatases in several forms of cancer. Low Molecular Weight Protein Tyrosine Phosphatase (LMWPTP; acid phosphatase 1 [ACP1]) is an 18 kDa enzyme that influences the phosphorylation of signaling pathway mediators involved in cancer and is thus postulated to be a tumor-promoting enzyme, but neither unequivocal clinical evidence nor convincing mechanistic actions for a role of LMWPTP have been identified. In the present study, we show that LMWPTP expression is not only significantly increased in colorectal cancer (CRC), but also follows a step-wise increase in different levels of dysplasia. Chemical inhibition of LMWPTP significantly reduces CRC growth. Furthermore, downregulation of LMWPTP in CRC leads to a reduced migration ability in both 2D- and 3D-migration assays, and sensitizes tumor cells to the chemotherapeutic agent 5-FU. In conclusion, this study shows that LMWPTP is not only overexpressed in colorectal cancer, but it is correlated with the malignant potential of this cancer, suggesting that this phosphatase may act as a predictive biomaker of CRC stage and represents a rational novel target in the treatment of this disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the effects of radiotherapy on salivary BPIFA expression and to investigate the role of BPIFA in the development of known radiotherapy side effects. Unstimulated whole-mouth saliva was collected from 45 cancer patients (1 week before treatment, during the treatment, and 1 week after completion of radiotherapy) and from 20 controls. BPIFA1 and BPIFA2 expression was detected by western blotting and analyzed along with clinicopathologic data and side effects from the radiotherapy. A facial radiation field was associated with lower salivary flow during and after radiotherapy and correlated with side effects, mainly mucositis. Salivary BPIFA1 expression levels were similar between the control group and the patient group before treatment. On the other hand, BPIFA2 levels were higher in the patient group before treatment compared with the control group. BPIFA concentration was modified by radiotherapy as BPIFA1 levels increased (P = .0081) and BPIFA2 decreased (P < .0001). Higher levels of BPIFA1 were associated with the presence of mucositis (P = .0363) and its severity (P = .0500). The present study found that levels of BPIFA1 and glycosylated forms of BPIFA2 are affected by radiotherapy, suggesting that these proteins may play a role in the oral microenvironment in irradiated patients with head and neck cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thyroid nodules are frequent findings, especially when sensitive imaging methods are used. Although thyroid cancer is relatively rare, its incidence is increasing, particularly in terms of small tumors, which have an uncertain clinical relevance. Most patients with differentiated thyroid cancer exhibit satisfactory clinical outcomes when treatment is appropriate, and their mortality rate is similar to that of the overall population. However, relapse occurs in a considerable fraction of these patients, and some patients stop responding to conventional treatment and eventually die from their disease. Therefore, the challenge is how to identify the individuals who require more aggressive disease management while sparing the majority of patients from unnecessary treatments and procedures. We have updated the Brazilian Consensus that was published in 2007, emphasizing the diagnostic and therapeutic advances that the participants, representing several Brazilian university centers, consider most relevant in clinical practice. The formulation of the present guidelines was based on the participants' experience and a review of the relevant literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física