Flora arbórea da bacia do rio Tibagi (Paraná, Brasil): Celastrales sensu Cronquist

A study of the tree species of the order Celastrales sensu Cronquist from the Tibagi river basin, Paraná state, Brazil, is presented, based on herbarium material. This basin is subdivided into three zones, from north to south: lower Tibagi (BT), mid Tibagi (MT) and upper Tibagi (AT), each with different environmental conditions and vegetation types. The order Celastrales is represented in the basin by 15 tree species belonging to three families: Aquifoliaceae, Celastraceae and Icacinaceae. Icacinaceae has only two species, Citronella gongonha and C. paniculata. The former is distinguished by a glabrous ovary and leaves that usually bear thorns. Aquifoliaceae has six species: Ilex brasiliensis, I. brevicuspis, I. chamaedryfolia, I. dumosa, I. paraguariensis and I. theezans. These species are found mainly in AT and MT and are distinguished by leaf size, indument, apices and margins, and by sepal features. Celastrales is represented by seven species and two genera; Plenckia populnea, a Brazilian savannah species found only in MT, and six species of Maytenus (M. evonymoides, M. robusta, M. dasyclada, M. salicifolia, M. ilicifolia and M. aquifolia) distinguished by leaf size and margins, branch shape and number of flowers per inflorescence.

Morfologia de plântulas de cinco leguminosas genistóides arbóreas do Brasil (Leguminosae-Papilionoideae)

This work aims to describe, illustrate and compare the seedling morphology of five tree species of the genera Bowdichia, Cyclolobium, Diplotropis, Ormosia, and Poecilanthe, which belong to the genistoid clade (Leguminosae Papilionoideae). Phanero-epigeal-foliaceous seedlings are found in Bowdichia virgilioides Kunth, Cyclolobium brasiliense Benth. has phanero-epigeal-reserve seedlings, while Ormosia arborea (Vell.) Harms, Diplotropis martiusii Benth., and Poecilanthe parviflora Benth. possess crypto-hypogeal-reserve seedlings. Some other relevant seedling morphological characters are discussed and compared with those of previously studied species in these genera.

Taxonomia do gênero Heliotropium L. (Heliotropiaceae) no Brasil

The taxonomy of the genus Heliotropium L. in Brazil was studied, revealing nine species and two varieties: H. amplexicaule Vahl, H. angiospermum Murray, H. curassavicum L., H. curassavicum var. argentinum I.M. Johnst., H. elongatum (Lehm.) I.M. Johnst., H. elongatum var. burchellii I.M. Johnst., H. indicum L., H. leiocarpum Morong, H. nicotianaefolium Poir., H. phylicoides Cham. and H. transalpinum Vell. Descriptions, illustrations, comments on relationships based on morphology and data on species distribution are presented.

O gênero Nectandra Rol. ex Rottb. (Lauraceae) no Estado do Paraná, Brasil

Nectandra Rol. ex Rottb. has 14 species in Paraná: Nectandra angustifolia (Schrader) Nees & Mart., N. cissiflora Nees, N. cuspidata Nees & Mart., N. grandiflora Nees & Mart., N. hihua (Ruiz & Pav.) Rohwer, N. lanceolata Nees & Mart., N. leucantha Nees & Mart., N. megapotamica (Sprengel) Mez, N. membranacea (Sw.) Griseb., N. nitidula Nees & Mart., N. oppositifolia Nees & Mart., N. paranaensis Coe-Teixeira, N. puberula (Schott) Nees and N. reticulata (Ruiz & Pav.) Mez. We present an identification key and species descriptions, as well as illustrations and data on phenology and geographic distribution. N. hihua is cited for the first time in Paraná State.

Taxonomia do gênero Euploca Nutt. (Heliotropiaceae) no Brasil

This work deals with a taxonomic study of the genus Euploca (Heliotropiaceae) in Brazil; seventeen species are recorded. A keyfor identification, descriptions, illustrations and comments, besides distribution, habitat, flowering and fruiting data for the species are presented.

Revisão taxonômica de Lonchocarpus s. str. (Leguminosae, Papilionoideae) do Brasil

A revision of the Brazilian species of Lonchocarpus s. str. is presented. This study is based on field observation and an analysis of approximately 1,200 herbarium collections. Nine species are recognized, L. cultratus, L. hedyosmus, L. latifolius, L. macrocarpus, L. nitidus, L. pluvialis, L. sericeus, L. spiciflorus, and L. violaceus, which grow in forests and are usually associated with river banks. Lonchocarpus sericeus and L. cultratus have a wide distribution throughout Brazil, whereas L. hedyosmus, L. macrocarpus, L. spiciflorus, and L. latifolius are restricted to the Amazonian domain. Lonchocarpus pluvialis occurs in the Central-West (Mato Grosso do Sul and Goiás) and Southeast (São Paulo) regions. Lonchocarpus violaceus is found in the states of Bahia and Espírito Santo, and is reported for the first time for Brazil. Identification keys, descriptions, and illustrations, in addition to information about habitat, geographic distribution and taxonomic and nomenclatural comments, are provided for the species. Four new synonyms and five lectotypifications are proposed.

Quantidade e Duração Silábicas em Português do Brasil

Analysis of existing relations between Non-linear Phonology models' predictions about syllable weight (quantity) (specially, Hayes' 1995 parametric metrical Phonology) and syllable duration at phonetic level. The data considered here is extracted from Gramática do Português Falado Project.

A lingüística indígena no Brasil

This article presents a panorama of the area of the linguistics of the indigenous languages in Brazil within the discipline of Brazilian linguiistics as a whole. Special attention is given to those aspects related to its specific development. It is argued that in contrast to what is commonly supposed, the arrival of the Summer Institute of Linguistics (1959) not only was not the beginning of this area of study in the country, but it even contributed to the delay in its establishment. It was only after the return of Brazilian scholars educated abroad who were interested in the study of the national indigenous languages that a specialized branch of linguistics directed to the study of these languages began to take form. The present situation of the area and perspectives for future development are both explored.

Os caminhos da pragmática no Brasil

This paper traces the history of the study of pragmatics in Brazil. It is shown that Brazilian researches have, by and large, remained attentive to major developments in the field taking place elsewhere in the world. Of particular importance is the burgeoning tendency to focus attention on social issues affecting the day-to-day lives of ordinary people. More and more researchers are realizing the need to assume a critical role in relation to the theories they encounter in the literature.

Folhas verdes, folhas secas, fibra do colmo e a clarificação do caldo de cana-de-açúcar

The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Uma nova espécie de Mimosa L. (Leguminosae, Mimosoideae) do Centro-Oeste do Brasil

A new species of Mimosa (Leguminosae, Mimosoideae, Mimosae) from Mato Grosso do Sul state, Midwestern Brazil, M. ferricola R.R. Silva & A.M.G. Azevedo, is described and illustrated. Morphologically M. ferricola is related to M. gemmulata Barneby and to M. nothopteris Barneby, and belongs to Mimosa sect. Batocaulon DC. ser. Leiocarpae Benth.

Tratamento da retinopatia diabética: percepções de pacientes em Rio Claro (SP) - Brasil

PURPOSE: To collect information and opinions from a group of diabetic patients regarding diabetic retinopathy and its treatment, in order to get reliable information that can help to improve programs and actions to control and prevent this ocular disease. METHODS: A cross-sectional study was performed. The sample was from 980 diabetic patients seen in a diabetic association. A previous questionnaire was made with general questions about the main subject. Thereafter, an appropriate questionnaire was prepared. RESULTS: The sample showed that among 299 patients with age ranging from 16 to 83 years, with a mean of 57 years, mainly female (67.91%) did not know how severe their disease was (30.8%), or believed that it was not a serious problem (19.7%). The laser technique to solve diabetic retinopathy was known by 60.2% of the patients. It was reported as the only treatment available by 24.1%. Among the reasons for no treatment 59.8% reported that they did not think it was necessary and 29.7% could not afford it. CONCLUSIONS: Patients showed lack of knowledge about how serious is diabetic retinopathy, the possibility of using laser technique for it and the severity of the disease. Some patients believed in the efficacy of the treatment and some patients did not, but all of them reported that they were afraid of submitting to it.

Prevalência de pterígio no município de Botucatu - Estado de São Paulo, Brasil

PURPOSE: To evaluate the prevalence of pterygium in a population-based sample at Botucatu City - São Paulo State, Brazil. METHODS: A population-based cross-sectional study with randomized clustered sampling of households was conducted in the urban area of the Botucatu City -São Paulo State, Brazil and 85.1% of the intended sample was evaluated. All participants were submitted to ophthalmologic examination and the data were statistically analyzed. RESULTS: The prevalence of pterygium lesion in Botucatu City was 8.12% (7.0% < CI < 9.2%), affecting mainly males (10.4% males X 6.5% females - 8.5% < CI < 12.3% for males and 5.1% < CI < 7.8% for females) with 49.6 ± 14.9 years old in average; 32.18% of the pterygium carriers aged between 40 and 50 years. CONCLUSIONS: The prevalence of pterygium at Botucatu is 8.12%, affecting most frequently 40-50 year-old males.

Centros de treinamento de ginástica rítmica no Brasil : estrutura e programas

Universidade Estadual de Campinas . Faculdade de Educação Física