Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Flicker perimetry in healthy subjects: influence of age and gender, learning effect and short-term fluctuation

PURPOSE: To determine the mean critical fusion frequency and the short-term fluctuation, to analyze the influence of age, gender, and the learning effect in healthy subjects undergoing flicker perimetry. METHODS: Study 1 - 95 healthy subjects underwent flicker perimetry once in one eye. Mean critical fusion frequency values were compared between genders, and the influence of age was evaluated using linear regression analysis. Study 2 - 20 healthy subjects underwent flicker perimetry 5 times in one eye. The first 3 sessions were separated by an interval of 1 to 30 days, whereas the last 3 sessions were performed within the same day. The first 3 sessions were used to investigate the presence of a learning effect, whereas the last 3 tests were used to calculate short-term fluctuation. RESULTS: Study 1 - Linear regression analysis demonstrated that mean global, foveal, central, and critical fusion frequency per quadrant significantly decreased with age (p<0.05).There were no statistically significant differences in mean critical fusion frequency values between males and females (p>0.05), with the exception of the central area and inferonasal quadrant (p=0.049 and p=0.011, respectively), where the values were lower in females. Study 2 - Mean global (p=0.014), central (p=0.008), and peripheral (p=0.03) critical fusion frequency were significantly lower in the first session compared to the second and third sessions. The mean global short-term fluctuation was 5.06±1.13 Hz, the mean interindividual and intraindividual variabilities were 11.2±2.8% and 6.4±1.5%, respectively. CONCLUSION: This study suggests that, in healthy subjects, critical fusion frequency decreases with age, that flicker perimetry is associated with a learning effect, and that a moderately high short-term fluctuation is expected.

Sensitivity and specificity of machine learning classifiers for glaucoma diagnosis using Spectral Domain OCT and standard automated perimetry

PURPOSE: To evaluate the sensitivity and specificity of machine learning classifiers (MLCs) for glaucoma diagnosis using Spectral Domain OCT (SD-OCT) and standard automated perimetry (SAP). METHODS: Observational cross-sectional study. Sixty two glaucoma patients and 48 healthy individuals were included. All patients underwent a complete ophthalmologic examination, achromatic standard automated perimetry (SAP) and retinal nerve fiber layer (RNFL) imaging with SD-OCT (Cirrus HD-OCT; Carl Zeiss Meditec Inc., Dublin, California). Receiver operating characteristic (ROC) curves were obtained for all SD-OCT parameters and global indices of SAP. Subsequently, the following MLCs were tested using parameters from the SD-OCT and SAP: Bagging (BAG), Naive-Bayes (NB), Multilayer Perceptron (MLP), Radial Basis Function (RBF), Random Forest (RAN), Ensemble Selection (ENS), Classification Tree (CTREE), Ada Boost M1(ADA),Support Vector Machine Linear (SVML) and Support Vector Machine Gaussian (SVMG). Areas under the receiver operating characteristic curves (aROC) obtained for isolated SAP and OCT parameters were compared with MLCs using OCT+SAP data. RESULTS: Combining OCT and SAP data, MLCs' aROCs varied from 0.777(CTREE) to 0.946 (RAN).The best OCT+SAP aROC obtained with RAN (0.946) was significantly larger the best single OCT parameter (p<0.05), but was not significantly different from the aROC obtained with the best single SAP parameter (p=0.19). CONCLUSION: Machine learning classifiers trained on OCT and SAP data can successfully discriminate between healthy and glaucomatous eyes. The combination of OCT and SAP measurements improved the diagnostic accuracy compared with OCT data alone.

Em jogo a relação entre pesquisador e clube : futebol e processos grupais

Universidade Estadual de Campinas . Faculdade de Educação Física

O rugbi em cadeira de rodas : aspectos tecnicos e taticos e diretrizes para seu desenvolvimento

Universidade Estadual de Campinas . Faculdade de Educação Física

Procedimentos pedagogicos para o ensino das lutas : contextos e possibilidades

Universidade Estadual de Campinas . Faculdade de Educação Física

Desenvolvimento de um laboratorio basico de biomecanica

Universidade Estadual de Campinas. Faculdade de Educação Física

Modelo de inclusão digital para construção do conhecimento em qualidade de vida e atividade fisica

Universidade Estadual de Campinas. Faculdade de Educação Física

Pedagogia do esporte : organização, sistematização, aplicação e avaliação de conteúdos esportivos na educação não formal = Sport pedagogy : organization, systematization and application of sports content in non-formal education

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia do esporte : pressupostos para uma teoria da avaliação da aprendizagem = Sport pedagogy: presuppositions for a learning assessment theory

Universidade Estadual de Campinas . Faculdade de Educação Física

Formação e desenvolvimento profissional do treinador : um estudo sobre os treinadores de basquetebol, suas identidade e saberes

Universidade Estadual de Campinas. Faculdade de Educação Física

A visão estrategico-tatica de tecnicos campeões da Liga Nacional de Futsal

Universidade Estadual de Campinas . Faculdade de Educação Física

Da formação e desenvolvimento profissional do professor de educação fisica a inovação educativa

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol para cegos (futebol de cinco) no Brasil : leitura do jogo e estrategias tatico-tecnicas

Universidade Estadual de Campinas . Faculdade de Educação Física

Possibilidades corporais como expressão da inteligencia humana no processo de ensino-aprendizagem

Universidade Estadual de Campinas . Faculdade de Educação Física