Interaction Between Fiscal And Monetary Policy In A Dynamic Nonlinear Model.

The objective of this study is to verify the dynamics between fiscal policy, measured by public debt, and monetary policy, measured by a reaction function of a central bank. Changes in monetary policies due to deviations from their targets always generate fiscal impacts. We examine two policy reaction functions: the first related to inflation targets and the second related to economic growth targets. We find that the condition for stable equilibrium is more restrictive in the first case than in the second. We then apply our simulation model to Brazil and United Kingdom and find that the equilibrium is unstable in the Brazilian case but stable in the UK case.

Quality Of Life Of Coronary Artery Disease Patients After The Implementation Of Planning Strategies For Medication Adherence.

to compare the general and specific health-related quality of life (HRQoL) between the Intervention (IG) and Control (CG) groups of coronary artery disease patients after the implementation of Action Planning and Coping Planning strategies for medication adherence and to verify the relationship between adherence and HRQoL. this was a controlled and randomized study. the sample (n=115) was randomized into two groups, IG (n=59) and CG (n=56). Measures of medication adherence and general and specific HRQoL were obtained in the baseline and after two months of monitoring. the findings showed that the combination of intervention strategies - Action Planning and Coping Planning for medication adherence did not affect the HRQoL of coronary artery disease patients in outpatient monitoring.

Key Participants Of The Tumor Microenvironment Of The Prostate: An Approach Of The Structural Dynamic Of Cellular Elements And Extracellular Matrix Components During Epithelial-stromal Transition.

Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.

Cota racial e estado: abolição do racismo ou direitos de raça?

The objective of this article is to examine the current government proposal of racialization in the Brazilian population, in order to offer support to affirmative action programs that meet the specific needs of those who classify themselves as black. Firstly we focused on the revival of the notion of race among scholars, politicians, and anti-racism activists, as well as on the difficulty in determining who is black in Brazil. Next we examined the racial quota system in the United States and its proclaimed success. Finally, we assessed the extent to which the introduction of racial quota in employment and university enrollment should be imposed as the sole political option for those intending to eliminate racism in Brazilian society.

Simulação da varredura da superfície por um cortador de base segmentado

Base cutting and feeding into harvesters of plants lying close to the ground surface require an efficient sweeping action of the cutting mechanism. It is not the case of conventional sugarcane harvesters which have rigid blades mounted on discs capable to contaminate the cane with dirt as well as damage the ratoons. The objective of this work was to simulate the sweeping performance of a segmented base cutter. The model was developed using the laws of dynamic. Simulation included two rotational speeds (400 and 600 rpm), two cutting heights (0.12 and 0.13 m) and two disk tilting angles (-10º and -12º). The simulated sweeping angle varied between 56º and 193º, which are very promising as a mean to cutting and feeding cane sticks lying on the ground. Cutting height was the variable that affected sweeping action the most. This behavior indicates the need to have an automatic control of the cutting disk height in order to keep good sweeping performance as the harvester moves forward.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Adaptação do handebol para a prática em cadeira de rodas

Universidade Estadual de Campinas . Faculdade de Educação Física

O esporte paraolímpico no Brasil : abordagem da sociologia do esporte de Pierre Bourdieu

Universidade Estadual de Campinas . Faculdade de Educação Física

Auto-eficácia docente e motivação para a realização do(a) professor(a) de Educação Física Adaptada

Universidade Estadual de Campinas . Faculdade de Educação Física

Esporte e clube sócio-esportivo : percurso, contextos e perspectivas a partir de um estudo de caso em clube esportivo espanhol

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise da descontinuidade do patrocinio esportivo em clubes de futebol no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

O jogo de futebol : investigação de sua estrutura, de seus modelos e da inteligencia de jogo, do ponto de vista da complexidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividade motora adaptada : o conhecimento produzido nos programas Stricto Sensu em Educação Física no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

O jogo de futebol no contexto escolar e extraescolar : encontro, confronto e atualização

Universidade Estadual de Campinas . Faculdade de Educação Física

Paramentros fisiologicos, motores e morfologicos de bailarinas classicas

Universidade Estadual de Campinas . Faculdade de Educação Física