Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Association of insulin resistance and GLP-2 secretion in obesity: a pilot study

OBJECTIVE: The objective of this pilot study was to determine whether glugagon-like peptide 2 (GLP-2) secretion relates to insulin sensitivity (IS) in obese subjects. SUBJECTS AND METHODS: Twenty four obese subjects [body mass index (BMI) 40.0 ± 3.0 kg/m² (mean ± standard deviation)] were included, nine of which were male, age 43 ± 8 years. Twelve subjects had type 2 diabetes, all treated with oral anti-diabetic agents only. The subjects were submitted to standard meal tolerance test (MTT) for dosage of the curves: glucose, insulin, and GLP-2. Insulin sensitivity was measured by HOMA-IR, and OGIS was derived from the MTT. Spearman linear correlations and partial correlations were obtained. RESULTS: There was an inverse relationship between the GLP-2 secretion and IS: HOMA-IR correlated with GLP-2 AUC (R = 0.504; p = 0.012), and OGIS correlated with GLP-2 incremental AUC (R = -0.54; p = 0.054). The correlation persisted after controlling for BMI. CONCLUSION: We found an association of GLP-2 secretion and insulin resistance (IR). The understanding of the underlying mechanisms may provide future directions in the pharmacological manipulation of incretins, and in the treatment of obesity and related metabolic disorders.

Creatina quinase e dor muscular tardia na musculação : estudo experimental em adultos e jovens com o "circuit weight training" e o "multiple set system"

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise das capacidades de resistencia, força e velocidade na periodização de modalidades intermitentes

Universidade Estadual de Campinas . Faculdade de Educação Física

Respostas agudas da variabilidade da frequência cardíaca após sesão de exercício de força com restrição de fluxo sanguíneo = : Acute responses of heart rate variabiblity afer blood flow restriction resistance exercise

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito de diferentes protocolos de treinamento sobre o risco cardiovascular global = : Effects of different training programs on global cardiovascular risk

Universidade Estadual de Campinas . Faculdade de Educação Física

Da formação e desenvolvimento profissional do professor de educação fisica a inovação educativa

Universidade Estadual de Campinas . Faculdade de Educação Física

Ciclimo de velocidade : uma proposta de controle da preparação fisica especial

Universidade Estadual de Campinas . Faculdade de Educação Física

Educação fisica na 1ª serie do ensino medio : uma pratica por compromisso

Universidade Estadual de Campinas . Faculdade de Educação Física

Futebol : as cargas concentradas de força e a dinamica da alteração das capacidades biomotoras no macrociclo anual de treinamento

Universidade Estadual de Campinas . Faculdade de Educação Física