33 resultados para secondary structure detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Metastasizing pleomorphic adenoma (MPA) is a rare tumour, and its mechanism of metastasis still is unknown. To date, there has been no study on MPA genomics. We analysed primary and secondary MPAs with array comparative genomic hybridization to identify somatic copy number alterations and affected genes. Tumour DNA samples from primary (parotid salivary gland) and secondary (scalp skin) MPAs were subjected to array comparative genomic hybridization investigation, and the data were analysed with NEXUS COPY NUMBER DISCOVERY. The primary MPA showed copy number losses affecting 3p22.2p14.3 and 19p13.3p123, and a complex pattern of four different deletions at chromosome 6. The 3p deletion encompassed several genes: CTNNB1, SETD2, BAP1, and PBRM1, among others. The secondary MPA showed a genomic profile similar to that of the primary MPA, with acquisition of additional copy number changes affecting 9p24.3p13.1 (loss), 19q11q13.43 (gain), and 22q11.1q13.33 (gain). Our findings indicated a clonal origin of the secondary MPA, as both tumours shared a common profile of genomic copy number alterations. Furthermore, we were able to detect in the primary tumour a specific pattern of copy number alterations that could explain the metastasizing characteristic, whereas the secondary MPA showed a more unbalanced genome.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Interactions between flowers and their visitors span the spectrum from mutualism to antagonism. The literature is rich in studies focusing on mutualism, but nectar robbery has mostly been investigated using phytocentric approaches focused on only a few plant species. To fill this gap, we studied the interactions between a nectar-robbing hermit hummingbird, Phaethornis ruber, and the array of flowers it visits. First, based on a literature review of the interactions involving  P. ruber, we characterized the association of floral larceny to floral phenotype. We then experimentally examined the effects of nectar robbing on nectar standing crop and number of visits of the pollinators to the flowers of Canna paniculata. Finally, we asked whether the incorporation of illegitimate interactions into the analysis affects plant-hummingbird network structure. We identified 97 plant species visited by P. ruber and found that P. ruber engaged in floral larceny in almost 30 % of these species. Nectar robbery was especially common in flowers with longer corolla. In terms of the effect on C. paniculata, the depletion of nectar due to robbery by P. ruber was associated with decreased visitation rates of legitimate pollinators. At the community level, the inclusion of the illegitimate visits of P. ruber resulted in modifications of how modules within the network were organized, notably giving rise to a new module consisting of P. ruber and mostly robbed flowers. However, although illegitimate visits constituted approximately 9 % of all interactions in the network, changes in nestedness, modularity, and network-level specialization were minor. Our results indicate that although a flower robber may have a strong effect on the pollination of a particular plant species, the inclusion of its illegitimate interactions has limited capacity to change overall network structure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Diagnostic imaging techniques play an important role in assessing the exact location, cause, and extent of a nerve lesion, thus allowing clinicians to diagnose and manage more effectively a variety of pathological conditions, such as entrapment syndromes, traumatic injuries, and space-occupying lesions. Ultrasound and nuclear magnetic resonance imaging are becoming useful methods for this purpose, but they still lack spatial resolution. In this regard, recent phase contrast x-ray imaging experiments of peripheral nerve allowed the visualization of each nerve fiber surrounded by its myelin sheath as clearly as optical microscopy. In the present study, we attempted to produce high-resolution x-ray phase contrast images of a human sciatic nerve by using synchrotron radiation propagation-based imaging. The images showed high contrast and high spatial resolution, allowing clear identification of each fascicle structure and surrounding connective tissue. The outstanding result is the detection of such structures by phase contrast x-ray tomography of a thick human sciatic nerve section. This may further enable the identification of diverse pathological patterns, such as Wallerian degeneration, hypertrophic neuropathy, inflammatory infiltration, leprosy neuropathy and amyloid deposits. To the best of our knowledge, this is the first successful phase contrast x-ray imaging experiment of a human peripheral nerve sample. Our long-term goal is to develop peripheral nerve imaging methods that could supersede biopsy procedures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Approximately 7.2% of the Atlantic rainforest remains in Brazil, with only 16% of this forest remaining in the State of Rio de Janeiro, all of it distributed in fragments. This forest fragmentation can produce biotic and abiotic differences between edges and the fragment interior. In this study, we compared the structure and richness of tree communities in three habitats - an anthropogenic edge (AE), a natural edge (NE) and the fragment interior (FI) - of a fragment of Atlantic forest in the State of Rio de Janeiro, Brazil (22°50'S and 42°28'W). One thousand and seventy-six trees with a diameter at breast height > 4.8 cm, belonging to 132 morphospecies and 39 families, were sampled in a total study area of 0.75 ha. NE had the greatest basal area and the trees in this habitat had the greatest diameter:height allometric coefficient, whereas AE had a lower richness and greater variation in the height of the first tree branch. Tree density, diameter, height and the proportion of standing dead trees did not differ among the habitats. There was marked heterogeneity among replicates within each habitat. These results indicate that the forest interior and the fragment edges (natural or anthropogenic) do not differ markedly considering the studied parameters. Other factors, such as the age from the edge, type of matrix and proximity of gaps, may play a more important role in plant community structure than the proximity from edges.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to evaluate the horizontal and vertical structures of tree community in regeneration in a fragment of a secondary riparian forest at approximately 30 years of age and to identify the most abundant species in each fragment of the forest to determine the sucessional stage. An area of 800 m² was subdivided into 16 samples of 10 x 5 m and all individuals with DBH ≥ 1 cm were sampled and identified for the following analyzes: horizontal parameters (DR, FR, DoR, IVC and IVI), vertical parameters (PSR and RNR) and mixed parameters, from of value of increased importance index (IVIa). The survey measured 689 individuals, belonging to 38 families, 74 genus and 109 species. The total density was 8,614 individuals/ha. The index of Shannon´s diversity was 3.99 and the index of Pielou´s equability was 0.85. Tibouchina pulchra, Psychotria suterella and Endlicheria paniculata obtained high values of IVIa. Guarea macrophylla, Gomidesia anacardiaefolia, Xylopia langsdorffiana and Endlicheria paniculata achieved high values of RNT, indicating adequate natural regeneration in the plot. The initial secondary and umbrophylous species showed the highest ecological importance in this fragment of the forest, with the highest values of sociologic position and importance index. Furthermore, the presence of late secondary species in all layers suggest that the studied fragment is in intermediate succession degree.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work was carried out with the objective of studying the spatial variability of the physical attributes of a Red-Yellow Ultisol under pasture and secondary vegetation in natural regeneration. Two areas were chosen in a hillside, with the soil sampling to the depth of 0-0.2 m, with the georeferenced points in a regular grid of 10x10 m, totalizing 64 points. In each point it was evaluated the total volume of porosity, macroporosity, microporosity, bulk density, soil penetration resistance and soil water content. The studied attributes in the pasture area present indicator of soil compaction for the animals' traffic, with moderate and strong structure of spatial dependence, except for the macroporosity and penetration resistance. In the area of secondary vegetation (VN) only the macroporosity does not present spatial dependence. The total volume of porosity and the bulk density present the same spatial standard in the area under pasture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.