Identificação eletrônica para avaliação do comportamento dos suínos na fase de gestação

The efficiency of swine production performance depends on the herd administration, such as good nutrition, sanitary control, facilities and appropriate environmental conditions. The concept of this production model is directly related with the reduction of selective losses and the process control. Each production segment is controlled to reach the optimization in the system totality, it is necessary to apply animals handling concepts, environmental control implementation, diseases control, nutrition control, information concerning in guaranteeing the animal welfare and individual identification. The present work presents as objective the development of the mathematical model to evaluate interactions among the internal atmosphere of the installation and the thermal animals preference, in the expectation of detecting a relationship among the frequency access to the drinking fountain and the atmosphere conditions - temperature, black globe temperature and relative humidity, using as tool the electronic identification. The results obtained by the mathematical model, allowed to conclude accurately the evaluation of the swine thermal preference correlating with the climatic variables in the pregnancy stage.

Proposta de mecanismo de lavagem em equipamentos de beneficiamento de tomate de mesa

The cleanness level in fresh market tomatoes cleaning equipment is essential for consumer acceptance and conservation of product quality. However, the washing process in cleaning current equipments demands an excessive volume of water, leading to serious economic and environmental concerns. The objective of this work was to contribute with technical information for the washing system optimization. The conventional washing system currently used in cleaning equipment, which consists of perforated PVC pipes, was compared with a proposed system which uses commercial sprays. Characteristic curves (flow rate versus pressure) for both systems were determined in lab conditions and the respective water consumptions were compared. The results confirmed the excess of water consumption in the conventional washing systems, and the proposed system proved that is possible to reduce it, and the use of sprays allowed the rational use of the water.

Efeitos da temperatura do ar, linhagem e período do dia nas freqüências de ocorrências e tempos de expressão comportamental de matrizes pesadas

Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.

Modelos estatísticos indicadores de comportamentos associados a bem-estar térmico para matrizes pesadas

The study of female broiler breeders is of great importance for the country as poultry production is one of the largest export items, and Brazil is the second largest broiler meat exporter. Animal behavior is known as a response to the effect of several interaction factors among them the environment. In this way the internal housing environment is an element that gives hints regarding to the bird s thermal comfort. Female broiler breeder behavior, expresses in form of specific pattern the bird s health and welfare. This research had the objective of applying predictive statistical models through the use of simulation, presenting animal comfort scenarios facing distinct environmental conditions. The research was developed with data collected in a controlled environment using Hybro - PG® breeding submitted to distinct levels of temperature, three distinct types of standard ration and age. Descriptive and exploratory analysis were proceeded, and afterwards the modeling process using the Generalized Estimation Equation (GEE). The research allowed the development of the thermal comfort indicators by statistical model equations of predicting female broiler breeder behavior under distinct studied scenarios.

Otimização da eficiência de limpeza em equipamento de beneficiamento de tomate de mesa

The post-harvesting cleaning process in fresh market tomatoes production is essential to the consumer acceptance, since the degree of dirtiness of the fruits is directly related to its quality. However, the washing stage of the cleaning process of commercial packinghouse demands an excessive water volume, bringing serious environmental concerns. The objective of this work was to compare the cleaning efficiency in two cleaning systems through the evaluation of different operational conditions of the cleaning process, related with the brush rotation, water flow and fruit standing time under the system. It was compared the conventional system utilized in commercial equipment with a system using commercial sprays. The results showed that the cleaning efficiency was not directly related to the water volume used, but to the water pressure, standing time and brushes rotation. Therefore, the use of commercial sprays can bring benefits to the cleaning efficiency, increasing it up to 13%, and to the environmental, decreasing water consumption.

Desidratação osmótica de abacaxi aplicada à tecnologia de métodos combinados

The aim of this research was to optimize osmotic dehydration of pineapple, according to two criteria: maximize water loss and minimize solid gain. The process was made as an application to Combined Methods Technology, in which three preservation factors were combined: water activity, pH and chemical preservatives, all being applied at low levels, in order to get a product resembling non-processed fruit. The experiment was divided into three treatments, being: non-coated pineapple pieces (A), pieces coated with alginate (B) and coated with low-methoxyl pectin (C). Process involved the following main steps: enzymatic inactivation of fruit pieces; in treatments B and C, incorporation of their respective coatings; and osmotic dehydration, in sucrose syrup containing potassium sorbate and citric acid. Optimum conditions, determined from Response Surface Methodology, were the following: dehydration of fruit pieces coated by alginate, at 42-47° C, in sucrose syrup at 66-69° Brix, for 220 to 270 minutes. Results indicated that both coatings significantly affected the mass transfers of the process, reducing solid incorporation and increasing water loss; therefore, increasing weight loss and performance ratio (water loss: solid incorporation) took place. Water activity was not significantly affected by the coatings. The product obtained under optimum conditions was submitted to sensorial evaluation, and presented a good general acceptance. Moulds and yeasts countings indicated good microbiological stability of the product for at least 60 days at 30ºC.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Metodos de avaliação em Educação Fisica no ensino fundamental

Universidade Estadual de Campinas . Faculdade de Educação Física

Esgrima em cadeira de rodas : pedagogia de ensino a partir das dimensões e contexto da modalidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Correlação entre o ponto de compensação respiratoria e desempenho em corredores de rua

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise do processo de rastreamento automatico de jogadores em esportes coletivos

Universidade Estadual de Campinas . Faculdade de Educação Física

A disciplina recreação e lazer no curriculo de formação de profissionais de Educação Fisica : o que dizem e fazem professores em Universidade do Nordeste do Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

A Escola Superior de Educação Fisica de Muzambinho no contexto da Educação Fisica brasileira

Universidade Estadual de Campinas . Faculdade de Educação Física

O aluno com deficiência visual nas aulas de educação física : análise do processo inclusivo = The student with visual impairments : analysis of inclusive process

Universidade Estadual de Campinas . Faculdade de Educação Física

Da formação e desenvolvimento profissional do professor de educação fisica a inovação educativa

Universidade Estadual de Campinas . Faculdade de Educação Física