62 resultados para ontology development methodology
Resumo:
There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.
Resumo:
• Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects.
Resumo:
Didanosine-loaded chitosan microspheres were developed applying a surface-response methodology and using a modified Maximum Likelihood Classification. The operational conditions were optimized with the aim of maintaining the active form of didanosine (ddI), which is sensitive to acid pH, and to develop a modified and mucoadhesive formulation. The loading of the drug within the chitosan microspheres was carried out by ionotropic gelation technique with sodium tripolyphosphate (TPP) as cross-linking agent and magnesium hydroxide (Mg(OH)2) to assure the stability of ddI. The optimization conditions were set using a surface-response methodology and applying the Maximum Likelihood Classification, where the initial chitosan concentration, TPP and ddI concentration were set as the independent variables. The maximum ddI-loaded in microspheres (i.e. 1433mg of ddI/g chitosan), was obtained with 2% (w/v) chitosan and 10% TPP. The microspheres depicted an average diameter of 11.42μm and ddI was gradually released during 2h in simulated enteric fluid.
Resumo:
Ropivacaine (RVC) is an aminoamide local anesthetic widely used in surgical procedures. Studies with RVC encapsulated in liposomes and complexed in cyclodextrins have shown good results, but in order to use RVC for lengthy procedures and during the postoperative period, a still more prolonged anesthetic effect is required. This study therefore aimed to provide extended RVC release and increased upload using modified liposomes. Three types of vesicles were studied: (i) large multilamellar vesicle (LMV), (ii) large multivesicular vesicle (LMVV) and (iii) large unilamellar vesicle (LUV), prepared with egg phosphatidylcholine/cholesterol/α-tocopherol (4:3:0.07 mol%) at pH 7.4. Ionic gradient liposomes (inside: pH 5.5, pH 5.5 + (NH4)2SO4 and pH 7.4 + (NH4)2SO4) were prepared and showed improved RVC loading, compared to conventional liposomes (inside: pH 7.4). An high-performance liquid chromatography analytical method was validated for RVC quantification. The liposomes were characterized in terms of their size, zeta potential, polydispersion, morphology, RVC encapsulation efficiency (EE(%)) and in vitro RVC release. LMVV liposomes provided better performance than LMV or LUV. The best formulations were prepared using pH 5.5 (LMVV 5.5in) or pH 7.4 with 250 mM (NH4)2SO4 in the inner aqueous core (LMVV 7.4in + ammonium sulfate), enabling encapsulation of as much as 2% RVC, with high uptake (EE(%) ∼70%) and sustained release (∼25 h). The encapsulation of RVC in ionic gradient liposomes significantly extended the duration of release of the anesthetic, showing that this strategy could be a viable means of promoting longer-term anesthesia during surgical procedures and during the postoperative period.
Resumo:
To develop Y-shaped plates with different thicknesses to be used in simulated fractures of the mandibular condyle. Ten plates were developed in Y shape, containing eight holes, and 30 synthetic polyurethane mandible replicas were developed for the study. The load test was performed on an Instron Model 4411 universal testing machine, applying load in the mediolateral and anterior-posterior positions on the head of the condyle. Two-way ANOVA with Tukey testing with a 5% significance level was used. It was observed that when the load was applied in the medial-lateral plate of greater thickness (1.5 mm), it gave the highest strength, while in the anteroposterior direction, the plate with the highest resistance was of the lesser thickness (0.6 mm). A plate with a thickness of 1.5 mm was the one with the highest average value for all displacements. In the anteroposterior direction, the highest values of resistance were seen in the displacement of 15 mm. After comparing the values of the biomechanical testing found in the scientific literature, it is suggested that the use of Y plates are suitable for use in subcondylar fractures within the limitations of the study.
Resumo:
This article is part of a study considering the growing importance of the international transit of people, knowledge, and practices in the schooling and professional education processes of some social segments. Considering the public funds made available by the Coordination for the Improvement of Higher Education Personnel - Capes -, the National Council for Scientific and Technological Development - CNPq - and the State of São Paulo Research Foundation - Fapesp - to support researchers' fellowships abroad, aming to improve research and investments on Science and Technology on the context of international exchanges, we have dedicated this article to the preliminary description and analysis of the database of fellows funded abroad by these research agencies from 1970 to 2000. The movement of flows based on the quantitative methodology of the correlation of variables draws the trends of international academic exchange programs in the three research institutions and in the different areas of knowledge, and we intend to analyse them taking into account the scientific and technological development policies adopted by Brazilian State on the period.
Resumo:
Currently, owing to the occurrence of environmental problems, along with the need of environmental preservation, both the territory management of Hydrographic Basin and the conservation of natural resources have proven to have remarkable importance. Thus, the mean goal of the research is to raise and scrutinize social-economic and technologic data from the Mogi Guaçu River Hydrographic Basin (São Paulo, Brazil). The aim is to group municipalities with similar characteristics regarding the collected data, which may direct joint actions in the Hydrographic Basin Management. There were used both the methods of factorial analysis and automatic hierarchical classifications. Additionally, there is going to be applied a Geographical Information System to represent the outcomes of the methods aforementioned, through the evolvement of a geo-referenced database, which will allow the obtainment of information categorically distributed including theme maps of interest. The main characteristics adopted to group the municipalities were: agricultural area, sugar cane production, small farms, animal production, number of agriculture machinery and equipments and agricultural income. The methodology adopted in the Mogi Guaçu River Hydrographic Basin will be analyzed vis-à-vis its appropriateness on basin management, as well as the possibility of assisting the studies on behalf of the São Paulo Hydrographic Basin groups, to regional development.
Resumo:
This article intends to discuss the relationship between morality, democracy and education within the perspective of the complex thinking, pointing to paths and proposals for its effective implementation in the educational routine, under the conviction that this is an imperative of the new social demands presented to the contemporary schooling. Understanding that one of the purposes of education is the ethical development, the author proposes intentional actions such that through them the school practices can offer to the subjects of education the necessary tools to build their cognitive, affective, cultural, and organic competence, thereby enabling them to act morally in the world. To that effect, seven aspects of school reality that hamper or contribute to school democratization are identified and discussed, which must be understood from the paradigm of complexity: school contents, classroom methodology, the nature of interpersonal relationships, the values, self-esteem and self-knowledge of the school community, as well as the school management processes.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This article reports the results from the research work which objects the critical and profound study about the ADHD (Attention Deficit/Hyperactivity Disorder) in the courses for teachers' development in College Education, under its various dimensions - social, cultural, pedagogical, biological. The investigation focused on five adults with diagnosis for ADHD. The methodology used was the Case Study, developed from the Oral History as a source of data. The results that were obtained suggest that the study, proposed in the research, may contribute significantly for the teachers to know determining factors of the school performance of students with this disorder, as well as to guide them in the search of partnership with other professionals - doctors and psychologists, for example - when such partnership becomes necessary.
Resumo:
Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física