33 resultados para n-PCR


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Different types of water bodies, including lakes, streams, and coastal marine waters, are often susceptible to fecal contamination from a range of point and nonpoint sources, and have been evaluated using fecal indicator microorganisms. The most commonly used fecal indicator is Escherichia coli, but traditional cultivation methods do not allow discrimination of the source of pollution. The use of triplex PCR offers an approach that is fast and inexpensive, and here enabled the identification of phylogroups. The phylogenetic distribution of E. coli subgroups isolated from water samples revealed higher frequencies of subgroups A1 and B23 in rivers impacted by human pollution sources, while subgroups D1 and D2 were associated with pristine sites, and subgroup B1 with domesticated animal sources, suggesting their use as a first screening for pollution source identification. A simple classification is also proposed based on phylogenetic subgroup distribution using the w-clique metric, enabling differentiation of polluted and unpolluted sites.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oral squamous cell carcinoma is the most common type of cancer in the oral cavity, representing more than 90% of all oral cancers. The characterization of altered molecules in oral cancer is essential to understand molecular mechanisms underlying tumor progression as well as to contribute to cancer biomarker and therapeutic target discovery. Proteoglycans are key molecular effectors of cell surface and pericellular microenvironments, performing multiple functions in cancer. Two of the major basement membrane proteoglycans, agrin and perlecan, were investigated in this study regarding their role in oral cancer. Using real time quantitative PCR (qRT-PCR), we showed that agrin and perlecan are highly expressed in oral squamous cell carcinoma. Interestingly, cell lines originated from distinct sites showed different expression of agrin and perlecan. Enzymatically targeting chondroitin sulfate modification by chondroitinase, oral squamous carcinoma cell line had a reduced ability to adhere to extracellular matrix proteins and increased sensibility to cisplatin. Additionally, knockdown of agrin and perlecan promoted a decrease on cell migration and adhesion, and on resistance of cells to cisplatin. Our study showed, for the first time, a negative regulation on oral cancer-associated events by either targeting chondroitin sulfate content or agrin and perlecan levels.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Intronic thyroid-stimulating hormone receptor polymorphisms have been associated with the risk for both Graves' disease and Graves' ophthalmopathy, but results have been inconsistent among different populations. We aimed to investigate the influence of thyroid-stimulating hormone receptor intronic polymorphisms in a large well-characterized population of GD patients. We studied 279 Graves' disease patients (231 females and 48 males, 39.80 ± 11.69 years old), including 144 with Graves' ophthalmopathy, matched to 296 healthy control individuals. Thyroid-stimulating hormone receptor genotypes of rs179247 and rs12885526 were determined by Real Time PCR TaqMan(®) SNP Genotyping. A multivariate analysis showed that the inheritance of the thyroid-stimulating hormone receptor AA genotype for rs179247 increased the risk for Graves' disease (OR = 2.821; 95 % CI 1.595-4.990; p = 0.0004), whereas the thyroid-stimulating hormone receptor GG genotype for rs12885526 increased the risk for Graves' ophthalmopathy (OR = 2.940; 95 % CI 1.320-6.548; p = 0.0083). Individuals with Graves' ophthalmopathy also presented lower mean thyrotropin receptor antibodies levels (96.3 ± 143.9 U/L) than individuals without Graves' ophthalmopathy (98.3 ± 201.9 U/L). We did not find any association between the investigated polymorphisms and patients clinical features or outcome. We demonstrate that thyroid-stimulating hormone receptor intronic polymorphisms are associated with the susceptibility to Graves' disease and Graves' ophthalmopathy in the Brazilian population, but do not appear to influence the disease course.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Previous studies on the role of inflammation in the pathophysiology of sickle cell disease (SCD) suggested that the CCR5Δ32 allele, which is responsible for the production of truncated C-C chemokine receptor type 5 (CCR5), could confer a selective advantage on patients with SCD because it leads to a less efficient Th1 response. We determined the frequency of the CCR5Δ32 polymorphism in 795 Afro-Brazilian SCD patients followed up at the Pernambuco Hematology and Hemotherapy Center, in Northeastern Brazil, divided into a pediatric group (3 months-17 years, n = 483) and an adult group (18-70 years, n = 312). The adult patients were also compared to a healthy control group (blood donors, 18-61 years, n = 247). The CCR5/CCR5Δ32 polymorphism was determined by allele-specific PCR. No homozygous patient for the CCR5Δ32 allele was detected. The frequency of heterozygotes in the study population (patients and controls) was 5.8%, in the total SCD patients 5.1%, in the children 5.4%, in the adults with SCD 4.8%, and in the adult controls 8.1%. These differences did not reach statistical significance. Our findings failed to demonstrate an important role of the CCR5Δ32 allele in the population sample studied here.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

To evaluate the modified US7 score (MUS7 score SYN) in the assessment of patients with early rheumatoid arthritis (ERA). In addition, dorsal and palmar recesses of the wrists as well as of small joints of the hands and feet were examined for the presence of synovitis by means of a global assessment of joints. The study sample comprised 32 patients treated for arthritis, with an average disease duration of 13 months. An ultrasound machine with high frequency transducer was used. Hands were also X-rayed and analysed by Larsen score. Out of the 832 examined joints, synovitis was detected in 173 (20,79%), tenosynovitis in 22 (4,91%), and erosions in 3 (1,56%). Synovitis was predominantly detected in the dorsal recess (73,38%) of MCP and PIP joints, when compared with palmar recess (26%). The presence of synovitis in the joints evaluated correlated with clinical (HAQ-DI, DAS28), laboratory (ACPA, RF, CRP), and ultrasound results (r = 0,37 to r = 0,42; p = 0,04 to p = 0,003). We found correlation of the MUS7 score SYN of the gray scale US or of the power Doppler US with DAS28 (PCR) values (r = 0,38; p = 0,0332), and with CRP results (r = 0,39; p = 0,0280), respectively. The dorsal recess, the wrist, and small joints can be considered as important sites to detect synovitis by the MUS7 score SYN in patients with ERA.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Bartonella species are blood-borne, re-emerging organisms, capable of causing prolonged infection with diverse disease manifestations, from asymptomatic bacteremia to chronic debilitating disease and death. This pathogen can survive for over a month in stored blood. However, its prevalence among blood donors is unknown, and screening of blood supplies for this pathogen is not routinely performed. We investigated Bartonella spp. prevalence in 500 blood donors from Campinas, Brazil, based on a cross-sectional design. Blood samples were inoculated into an enrichment liquid growth medium and sub-inoculated onto blood agar. Liquid culture samples and Gram-negative isolates were tested using a genus specific ITS PCR with amplicons sequenced for species identification. Bartonella henselae and Bartonella quintana antibodies were assayed by indirect immunofluorescence. B. henselae was isolated from six donors (1.2%). Sixteen donors (3.2%) were Bartonella-PCR positive after culture in liquid or on solid media, with 15 donors infected with B. henselae and one donor infected with Bartonella clarridgeiae. Antibodies against B. henselae or B. quintana were found in 16% and 32% of 500 blood donors, respectively. Serology was not associated with infection, with only three of 16 Bartonella-infected subjects seropositive for B. henselae or B. quintana. Bartonella DNA was present in the bloodstream of approximately one out of 30 donors from a major blood bank in South America. Negative serology does not rule out Bartonella spp. infection in healthy subjects. Using a combination of liquid and solid cultures, PCR, and DNA sequencing, this study documents for the first time that Bartonella spp. bacteremia occurs in asymptomatic blood donors. Our findings support further evaluation of Bartonella spp. transmission which can occur through blood transfusions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Human exposure to Bartonella clarridgeiae has been reported only on the basis of antibody detection. We report for the first time an asymptomatic human blood donor infected with B. clarridgeiae, as documented by enrichment blood culture, PCR, and DNA sequencing.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Placental tissue injury is concomitant with tumor development. We investigated tumor-driven placental damage by tracing certain steps of the protein synthesis and degradation pathways under leucine-rich diet supplementation in MAC16 tumor-bearing mice. Cell signaling and ubiquitin-proteasome pathways were assessed in the placental tissues of pregnant mice, which were distributed into three groups on a control diet (pregnant control, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid) and three other groups on a leucine-rich diet (pregnant, tumor-bearing pregnant, and pregnant injected with MAC-ascitic fluid). MAC tumor growth down-regulated the cell-signaling pathways of the placental tissue and decreased the levels of IRS-1, Akt/PKB, Erk/MAPK, mTOR, p70S6K, STAT3, and STAT6 phosphorylated proteins, as assessed by the multiplex Millipore Luminex assay. Leucine supplementation maintained the levels of these proteins within the established cell-signaling pathways. In the tumor-bearing group (MAC) only, the placental tissue showed increased PC5 mRNA expression, as assessed by quantitative RT-PCR, decreased 19S and 20S protein expression, as assessed by Western blot analysis, and decreased placental tyrosine levels, likely reflecting up-regulation of the ubiquitin-proteasome pathway. Similar effects were found in the pregnant injected with MAC-ascitic fluid group, confirming that the effects of the tumor were mimicked by MAC-ascitic fluid injection. Although tumor progression occurred, the degradation pathway-related protein levels were modulated under leucine-supplementation conditions. In conclusion, tumor evolution reduced the protein expression of the cell-signaling pathway associated with elevated protein degradation, thereby jeopardizing placental activity. Under the leucine-rich diet, the impact of cancer on placental function could be minimized by improving the cell-signaling activity and reducing the proteolytic process.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Maternal high-fat diet (HFD) impairs hippocampal development of offspring promoting decreased proliferation of neural progenitors, in neuronal differentiation, in dendritic spine density and synaptic plasticity reducing neurogenic capacity. Notch signaling pathway participates in molecular mechanisms of the neurogenesis. The activation of Notch signaling leads to the upregulation of Hes5, which inhibits the proliferation and differentiation of neural progenitors. This study aimed to investigate the Notch/Hes pathway activation in the hippocampus of the offspring of dams fed an HFD. Female Swiss mice were fed a control diet (CD) and an HFD from pre-mating until suckling. The bodyweight and mass of adipose tissue in the mothers and pups were also measured. The mRNA and protein expression of Notch1, Hes5, Mash1, and Delta1 in the hippocampus was assessed by RT-PCR and western blotting, respectively. Dams fed the HFD and their pups had an increased bodyweight and amount of adipose tissue. Furthermore, the offspring of mothers fed the HFD exhibited an increased Hes5 expression in the hippocampus compared with CD offspring. In addition, HFD offspring also expressed increased amounts of Notch1 and Hes5 mRNA, whereas Mash1 expression was decreased. However, the expression of Delta1 did not change significantly. We propose that the overexpression of Hes5, a Notch effector, downregulates the expression of the proneural gene Mash1 in the offspring of obese mothers, delaying cellular differentiation. These results provide further evidence that an offspring's hippocampus is molecularly susceptible to maternal HFD and suggest that Notch1 signaling in this brain region is important for neuronal differentiation.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física