Modelos de regressão lineares para estimativa de produtividade da soja no oeste do Paraná, utilizando dados espectrais

The main objective of this work was to evaluate the linear regression between spectral response and soybean yield in regional scale. In this study were monitored 36 municipalities from the west region of the states of Parana using five images of Landsat 5/TM during 2004/05 season. The spectral response was converted in physical values, apparent and surface reflectances, by radiometric transformation and atmospheric corrections and both used to calculate NDVI and GVI vegetation indices. Those ones were compared by multiple and simple regression with government official yield values (IBGE). Diagnostic processing method to identify influents values or collinearity was applied to the data too. The results showed that the mean surface reflectance value from all images was more correlated with yield than individual dates. Further, the multiple regressions using all dates and both vegetation indices gave better results than simple regression.

Formação das substâncias de reserva durante o desenvolvimento de sementes de urucum (Bixa orellana L. - Bixaceae)

Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.

Produção de serapilheira e decomposição do material foliar em um cerradão na Estação Ecológica de Jataí, município de Luiz Antônio, SP, Brasil

We estimate litter production and leaf decomposition rate in a cerradão area, physiognomy little studied and very threatened in São Paulo State. During the period of study, litter production was 5646.9 kg.ha-1.year-1, which the 'leaf' fraction corresponded to 4081.2 kg.ha¹.year¹; the 'branch' fraction, to 1066.1 kg.ha-1.year-1; the 'reproductive structures' fraction, to 434.1 kg.ha-1.year-1; and the 'miscellaneous' fraction to 65.5 kg.ha-1.year-1. Litter production was highly seasonal and negatively correlated with relative humidity and air temperature. Leaf production was negatively correlated with relative humidity, rainfall, and air temperature. There was no significant difference between litter production found in this study and those in two other sites with cerradão and semideciduous forest, but these physiognomies differed significantly from the cerrado sensu stricto. Leaf decomposition rate (K) was 0.56. Half-life of the decomposing material was 1.8 years and turnover time was 2.3 years.

Unidade Haugh como medida da qualidade de ovos de galinha armazenados sob refrigeração

Alterations in physical, chemical and functional characteristics of egg proteins occur during storage. These changes depend on the storage conditions, mainly duration, temperature and relative humidity. This study examined the fresh egg Haugh unit score and the storage egg Haugh unit score, at room temperature (25°C) and under refrigeration conditions (8°C), during 7, 14 and 21 days of storage. Haugh units and albumin height decreased considerably during storage at room temperature. At 8°C, there was no significant difference in the Haugh unit for different periods of storage, but their values were smaller as compared to fresh eggs. The weight of the eggs was not affected by both storage and temperature. For both temperatures, pH was positively correlated with Haugh units and negatively with the albumin height.

Projeto de caixa de madeira para manga (Mangifera Indica L.)

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Tissue culture of Cecropia glaziovii Sneth (urticaceae): vegetative micropropagation and plant regeneration from callus

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Atributos mecânicos e erosão por salpicamento em amostras de latossolo vermelho-amarelo sob efeito de vinhaça

The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.

CARACTERÍSTICAS DE QUALIDADE DO CONTRAFILÉ (m. L. dorsi) DE TOUROS JOVENS DA RAÇA NELORE

Quality traits of boneless rib cut (L. dorsi muscle) from Nelore young bulls. To study the meat quality traits of Nelore breed young bulls, and the effect of age (690-780 days) on them, 113 animals were slaughtered after 109 days of intensive feeding with 20% concentrate and 80% roughage. All the carcasses were graded at the slaughter floor by the Federal Inspection and chilled for 24 hours (Tinitial=5°C, Tfinal=2°C). Fifty one half carcasses (right side), type B - B R A S I L `s grading system - from animals of 23 to 26 months were boned and separated into commercial cuts. Two steaks (2.5cm thick) were removed from each boneless rib cut (m. L. dorsi), vacuum packaged and aged for 7 days (0-2°C). The pH varied from 5.44 to 5.83 and only two samples had pH ³ 5.70. The L* (brightness) average value was 34.85. The water and fat content were 75.65% and 1.71%, respectively. The average WB shear force was 6.70kg, and it was not affected by age (690-734 days), but presented a trend (t test, p=0.22) for increasing values between 735 and 780 days. Animal age did not affect other quality traits (t test, p>0.20). It was concluded that the rib cut from Nelore young bulls may not have a good acceptability in exigent markets, and that carcasses graded B, presumed to be the best grade, do not necessarily present the best meat quality characteristics.

Avaliação do amaciamento de carne bovina de dianteiro (Triceps brachii) pelos métodos de maturação, estimulação elétrica, injeção de ácidos e tenderização mecânica

Twenty-two Triceps brachii muscle obtained from 11 cows aged 3 and 4 years , killed in an experimental slaughter plant, were submitted to mechanical tenderization, injection with acetic acid 0,1M and lactic acid 0,2M, ageing for 9 and 14 days and electrical stimulation (250v - 60Hz - 90s), some of them were reserved as a control group, without treatment. The 14 days ageing time presented 21% of increase in subjective tenderness and 12% of reduction in shear force, these values were similar to the electrical stimulated meat. However the injection with acids and the ageing time 9 days did not present significant effect in the texture. Although the shear force values of mechanical tenderized meat was the shortest among all treatments, suspect of superestimation because of the fractures plan created by this process. Another analyses were carried out: pH reduction curve, R value; colour analysis; weight losses by cooking and by treatment; and microbiological analysis.

Caracterização sensorial de amêndoas de castanha-de-caju fritas e salgadas

Shelled, roasted and salted cashew nut kernels were packaged in three different flexible materials (PP/PE= polypropylene / polyethylene; PETmet/PE= metallized polyethylene terephthalate / polyethylene; PET/Al/LDPE= polyethylene terephthalate / aluminum foil / low density polyethylene ), with different barrier properties. Kernels were stored for one year at 30° C and 80% relative humidity. Quantitative descriptive sensory analysis (QDA) were performed at the end of storage time. Descriptive terms obtained for kernels characterization were brown color, color uniformity and rugosity for appearance; toasted kernel, sweet, old and rancidity for odor; toasted kernel, sweet, old rancidity, salt and bitter for taste, crispness for texture. QDA showed that factors responsible for sensory quality decrease, after one year storage, were increase in old aroma and taste, increase in rancidity aroma and taste, decrease in roasted kernel aroma and taste, and decrease of crispness. Sensory quality decrease was higher in kernels packaged in PP/PE.

Desidratação osmótica de abacaxi aplicada à tecnologia de métodos combinados

The aim of this research was to optimize osmotic dehydration of pineapple, according to two criteria: maximize water loss and minimize solid gain. The process was made as an application to Combined Methods Technology, in which three preservation factors were combined: water activity, pH and chemical preservatives, all being applied at low levels, in order to get a product resembling non-processed fruit. The experiment was divided into three treatments, being: non-coated pineapple pieces (A), pieces coated with alginate (B) and coated with low-methoxyl pectin (C). Process involved the following main steps: enzymatic inactivation of fruit pieces; in treatments B and C, incorporation of their respective coatings; and osmotic dehydration, in sucrose syrup containing potassium sorbate and citric acid. Optimum conditions, determined from Response Surface Methodology, were the following: dehydration of fruit pieces coated by alginate, at 42-47° C, in sucrose syrup at 66-69° Brix, for 220 to 270 minutes. Results indicated that both coatings significantly affected the mass transfers of the process, reducing solid incorporation and increasing water loss; therefore, increasing weight loss and performance ratio (water loss: solid incorporation) took place. Water activity was not significantly affected by the coatings. The product obtained under optimum conditions was submitted to sensorial evaluation, and presented a good general acceptance. Moulds and yeasts countings indicated good microbiological stability of the product for at least 60 days at 30ºC.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Utilização dos testes de função tireoidiana na prática clínica

Laboratory tests are essential for accurate diagnosis and cost-effective management of thyroid disorders. When the clinical suspicion is strong, hormonal levels just confirms the diagnosis. However, in most patients, symptoms are subtle and unspecific, so that only biochemical tests can detect the disorder. The objective of this article is to do a critical analysis of the appropriate use of the most important thyroid function tests, including serum concentrations of thyrotropin (TSH), thyroid hormones and antithyroid antibodies. Through a survey in the MedLine database, we discuss the major pitfalls and interferences related to daily use of these tests and recommendations are presented to optimize the use of these diagnostic tools in clinical practice.

Crescimento fisico em crianças e adolescentes de moderada altitude

Universidade Estadual de Campinas . Faculdade de Educação Física

Comparação entre diferentes ciclo simuladores e ciclismo em velódromo : testes de desempenho máximo de 5 quilômetros

Universidade Estadual de Campinas . Faculdade de Educação Física