Utilização de 1-metilciclopropeno e resfriamento rápido na conservação de pêssegos

Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.

Otimização da eficiência de limpeza em equipamento de beneficiamento de tomate de mesa

The post-harvesting cleaning process in fresh market tomatoes production is essential to the consumer acceptance, since the degree of dirtiness of the fruits is directly related to its quality. However, the washing stage of the cleaning process of commercial packinghouse demands an excessive water volume, bringing serious environmental concerns. The objective of this work was to compare the cleaning efficiency in two cleaning systems through the evaluation of different operational conditions of the cleaning process, related with the brush rotation, water flow and fruit standing time under the system. It was compared the conventional system utilized in commercial equipment with a system using commercial sprays. The results showed that the cleaning efficiency was not directly related to the water volume used, but to the water pressure, standing time and brushes rotation. Therefore, the use of commercial sprays can bring benefits to the cleaning efficiency, increasing it up to 13%, and to the environmental, decreasing water consumption.

Avaliação de linhas de beneficiamento e impactos de queda na qualidade de caqui Rama Forte

Excessive and inadequate handling of fruits and vegetables provides high incidences of physical damage, consequently, post harvest losses. The main goal of this work was to evaluate the impact magnitude in persimmon packing lines, Rama Forte, and to determine, at the laboratory, its impact limits. For evaluating the critical points it was used an instrumented sphere of 76 mm of diameter (Technmark, Inc, Lansing, USA), which registered the impact magnitude in seven distinctive impact lines located in four packing houses. For determining physical damages, tests were carried out at the laboratory, where fruit drop was related to impact magnitude, physical damage incidence and fruit post harvest losses. At the packing lines, the values found varied from 21 to 87 G on the transfer points and the majority of registered impacts (over 94%) were down 50G. Drops from 20 cm caused an increase in weight losses after six days of storage at room temperature. Drops from 20 and 30 cm caused skin darkness (low L values), associated to a decrease in color intensity (chroma). Impact drop did not affect pulp fruit chemical features.

The relationship between physical aspects of quality of life and extreme levels of regular physical activity in adults

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Quality of life in patients with ileal pouch for ulcerative colitis

INTRODUCTION:proctocolectomy with ileal pouch-anal anastomosis (IPAA) is the standard surgical procedure for the treatment of ulcerative colitis (UC) and is associated with the prospect of cure. Experience gained over the years has demonstrated the occurrence of a high number of complications as well as bowel disorders that can compromise quality of life (QoL).OBJECTIVE:evaluate QoL in patients with IPAA for ulcerative colitis.PATIENTS AND METHODS:the Inflammatory Bowel Disease Questionnaire (IBDQ) was used to assess QoL in patients with IPAA after its validation in Portuguese.RESULTS:thirty-one patients submitted to IPAA by the same group of professionals were evaluated. QoL was classified as regular in all domains evaluated (intestinal and systemic symptoms and emotional and social aspects). There were no differences in relation to gender, type of pouch or postoperative time. However, elderly patients showed a tendency toward lower scores. Having a professional activity was associated with higher scores in systemic symptoms and social aspects (p < 0.05). Patients with ileostomy showed lower values in the domains of systemic symptoms, emotional and social aspects (p <0.05).CONCLUSION:in all domains assessed, patients with IPAA for UC had QoL classified as regular. Ileostomy and lack of professional activity negatively influenced QoL.

Qualidade de vida e composição corporal : características do envelhecimento bem sucedido = Quality of life and body composition : characteristics of successful aging

Universidade Estadual de Campinas . Faculdade de Educação Física

Possibilidades e limites da avaliação da qualidade de vida : análise dos instrumentos WHOQOL e modelos clássicos de qualidade de vida no trabalho = Possibilities and limits of quality of life assessment : analysis of WHOQOL instruments and quality of work life classical models

Universidade Estadual de Campinas . Faculdade de Educação Física