Determination Of The Phenolic Composition From Brazilian Tropical Fruits By Uhplc-ms/ms.

Although Brazil is the third largest fruit producer in the world, several specimens consumed are not well studied from the chemical viewpoint, especially for quantitative analysis. For this reason and the crescent employment of mass spectrometry (MS) techniques in food science we selected twenty-two phenolic compounds with important biological activities and developed an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS) method using electrospray (ESI) in negative ion mode aiming their quantification in largely consumed Brazilian fruits (açaí-do-Amazonas, acerola, cashew apple, camu-camu, pineapple and taperebá). Multiple reaction monitoring (MRM) was applied and the selection of proper product ions for each transition assured high selectivity. Linearity (0.995detection (28.85-333.3pg/mL), limit of quantification (96.15-1111pg/mL), inter- and intraday accuracy (>80%), precision (CV<20%) and extraction recovery rate (>80%) were satisfactory and showed that the method provides an efficient protocol to analyze phenolic compounds in fruit pulp extracts.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Authenticity study of Phyllanthus species by NMR and FT-IR Techniques coupled with chemometric methods

The importance of medicinal plants and their use in industrial applications is increasing worldwide, especially in Brazil. Phyllanthus species, popularly known as quebra-pedras in Brazil, are used in folk medicine for treating urinary infections and renal calculus. This paper reports an authenticity study, based on herbal drugs from Phyllanthus species, involving commercial and authentic samples using spectroscopic techniques: FT-IR, ¹H HR-MAS NMR and ¹H NMR in solution, combined with chemometric analysis. The spectroscopic techniques evaluated, coupled with chemometric methods, have great potential in the investigation of complex matrices. Furthermore, several metabolites were identified by the NMR techniques.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Proposição e avaliação de um método baseado em projeção de luz para reconstrução e análise da superfície do tronco durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física

Rastreamento automatico de trajetorias de jogadores de futebol por videogrametria : validação do metodo e analise dos resultados

Universidade Estadual de Campinas . Faculdade de Educação Física