24 resultados para densidade do hospedeiro


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Two kinds of roasting cocoa system: conventional batch method in electrical oven, and by microwaves, in a continuous microwave rotary applicator (2450MHz), were compared with respect to viscosity. Cocoa was roasted in whole beans and in nibs. The variable used in the microwave treatment was the power density applied to the whole beans (254,45 to 290,80 Wh/kg) and to the nibs (227,27 to 262,23 Wh/kg), with a constant holding time of 10 minutes. The variable used in the conventional roasting process was the roasting time of the beans (40 to 44 min) and the nibs (34 to 38 min), with constant temperature in the jacket of electric oven (150°C). Viscosity was measured in a Brookfield rheometer (mod RV-DVIII) at 40°C. In general, the plastic viscosity of the microwaved samples was lower than that of the conventional roasted samples. Also the nibs showed lower viscosities than the whole beans when roasted in the electric oven. The viscosity of the samples roasted in the microwave oven was lower in the whole beans than in the nibs. The product was sensorially evaluated by three experts in cocoa flavour, and it was shown that the flavour of the microwave roasted products was similar to that of the conventionally roasted products, with the advantage of a reduction in process time.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Shelled, roasted and salted cashew nut kernels were packaged in three different flexible materials (PP/PE= polypropylene / polyethylene; PETmet/PE= metallized polyethylene terephthalate / polyethylene; PET/Al/LDPE= polyethylene terephthalate / aluminum foil / low density polyethylene ), with different barrier properties. Kernels were stored for one year at 30° C and 80% relative humidity. Quantitative descriptive sensory analysis (QDA) were performed at the end of storage time. Descriptive terms obtained for kernels characterization were brown color, color uniformity and rugosity for appearance; toasted kernel, sweet, old and rancidity for odor; toasted kernel, sweet, old rancidity, salt and bitter for taste, crispness for texture. QDA showed that factors responsible for sensory quality decrease, after one year storage, were increase in old aroma and taste, increase in rancidity aroma and taste, decrease in roasted kernel aroma and taste, and decrease of crispness. Sensory quality decrease was higher in kernels packaged in PP/PE.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Report of an early case of Shy-Drager syndrome in a 67 year-old woman patient. Autonomic failure was diagnosed by functional evaluation as well as laboratory tests. MR imaging disclosed a prominent putamina hypodensity in T2-weighted images at high field strength due to iron increased depositing in this basal ganglia. MR imaging evidences confirm Shy-Drager syndrome diagnosis, and contributes for differential diagnosis of idiopathic hypotension (pure autonomic failure) in special in SDS early cases.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física