33 resultados para apical pericardial adhesion


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oral squamous cell carcinoma is the most common type of cancer in the oral cavity, representing more than 90% of all oral cancers. The characterization of altered molecules in oral cancer is essential to understand molecular mechanisms underlying tumor progression as well as to contribute to cancer biomarker and therapeutic target discovery. Proteoglycans are key molecular effectors of cell surface and pericellular microenvironments, performing multiple functions in cancer. Two of the major basement membrane proteoglycans, agrin and perlecan, were investigated in this study regarding their role in oral cancer. Using real time quantitative PCR (qRT-PCR), we showed that agrin and perlecan are highly expressed in oral squamous cell carcinoma. Interestingly, cell lines originated from distinct sites showed different expression of agrin and perlecan. Enzymatically targeting chondroitin sulfate modification by chondroitinase, oral squamous carcinoma cell line had a reduced ability to adhere to extracellular matrix proteins and increased sensibility to cisplatin. Additionally, knockdown of agrin and perlecan promoted a decrease on cell migration and adhesion, and on resistance of cells to cisplatin. Our study showed, for the first time, a negative regulation on oral cancer-associated events by either targeting chondroitin sulfate content or agrin and perlecan levels.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

During the last ten years, graphene oxide has been explored in many applications due to its remarkable electroconductivity, thermal properties and mobility of charge carriers, among other properties. As discussed in this review, the literature suggests that a total characterization of graphene oxide must be conducted because oxidation debris (synthesis impurities) present in the graphene oxides could act as a graphene oxide surfactant, stabilizing aqueous dispersions. It is also important to note that the structure models of graphene oxide need to be revisited because of significant implications for its chemical composition and its direct covalent functionalization. Another aspect that is discussed is the need to consider graphene oxide surface chemistry. The hemolysis assay is recommended as a reliable test for the preliminary assessment of graphene oxide toxicity, biocompatibility and cell membrane interaction. More recently, graphene oxide has been extensively explored for drug delivery applications. An important increase in research efforts in this emerging field is clearly represented by the hundreds of related publications per year, including some reviews. Many studies have been performed to explore the graphene oxide properties that enable it to deliver more than one activity simultaneously and to combine multidrug systems with photothermal therapy, indicating that graphene oxide is an attractive tool to overcome hurdles in cancer therapies. Some strategic aspects of the application of these materials in cancer treatment are also discussed. In vitro studies have indicated that graphene oxide can also promote stem cell adhesion, growth and differentiation, and this review discusses the recent and pertinent findings regarding graphene oxide as a valuable nanomaterial for stem cell research in medicine. The protein corona is a key concept in nanomedicine and nanotoxicology because it provides a biomolecular identity for nanomaterials in a biological environment. Understanding protein corona-nanomaterial interactions and their influence on cellular responses is a challenging task at the nanobiointerface. New aspects and developments in this area are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hemoglobin SC disease is a very prevalent hemoglobinopathy, however very little is known specifically about this condition. There appears to be an increased risk of thromboembolic events in hemoglobin SC disease, but studies evaluating the hemostatic alterations are lacking. We describe a cross-sectional observational study evaluating coagulation activation markers in adult hemoglobin SC patients, in comparison with sickle cell anemia patients and healthy controls. A total of 56 hemoglobin SC and 39 sickle cell anemia patients were included in the study, all in steady state, and 27 healthy controls. None of the patients were in use of hydroxyurea. Hemoglobin SC patients presented a significantly up-regulated relative expression of tissue factor, as well as elevations in thrombin-antithrombin complex and D-dimer, in comparison to controls (p<0.01). Hemoglobin SC patients presented lower tissue factor expression, and thrombin-antithrombin complex and D-dimer levels when compared to sickle cell anemia patients (p<0.05). Endothelial activation (soluble thrombomodulin and soluble vascular cell adhesion molecule-1), and inflammation (tumor necrosis factor-alpha) markers were both significantly elevated in hemoglobin SC patients when compared to controls, being as high as the levels seen in sickle cell anemia. Overall, in hemoglobin SC patients, higher hemolytic activity and inflammation were associated with a more intense activation of coagulation, and hemostatic activation was associated with two very prevalent chronic complications seen in hemoglobin SC disease: retinopathy and osteonecrosis. In summary, our results demonstrate that hemoglobin SC patients present a hypercoagulable state, although this manifestation was not as intense as that seen in sickle cell anemia.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study investigated the presence of the Treponema species in longstanding endodontic retreatment-resistant lesions of teeth with apical periodontitis, the association of this species with clinical/radiographic features, and the association among the different target species. Microbial samples of apical lesions were collected from twenty-five adult patients referred to endodontic surgery after unsuccessful root canal retreatment. Nested-PCR and conventional PCR were used for Treponema detection. Twenty-three periradicular tissue samples showed detectable levels of bacterial DNA. Treponema species were detected in 28% (7/25) of the cases. The most frequently detected species were T. socranskii (6/25), followed by T. maltophilum (3/25), T. amylovorum (3/25), T. lecithinolyticum (3/25), T. denticola (3/25), T. pectinovorum (2/25) and T. medium (2/25). T. vicentii was not detected in any sample. Positive statistical association was found between T. socranskii and T. denticola, and between T. maltophilum and T. lecithinolyticum . No association was detected between the presence of any target microorganism and the clinical or radiographic features. Treponema spp. are present, in a low percentage, in longstanding apical lesions from teeth with endodontic retreatment failure.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In diabetes mellitus (DM), podocyte apoptosis leads to albuminuria and nephropathy progression. Low-density lipoprotein receptor-related protein 6 (LRP6) is WNT pathway receptor that is involved in podocyte death, adhesion and motility. Glycogen synthase kinase 3 (GSK3) interaction with p53 (GSK3-p53) promotes apoptosis in carcinoma cells. It is unknown if GSK3-p53 contributes to podocyte apoptosis in DM. In experimental DM, green tea (GT) reduces albuminuria by an unknown mechanism. In the present study, we assessed the role of the GSK3β-p53 in podocyte apoptosis and the effects of GT on these abnormalities. In diabetic spontaneously hypertensive rats (SHRs), GT prevents podocyte's p-LRP6 expression reduction, increased GSK3β-p53 and high p53 levels. In diabetic SHR rats, GT reduces podocyte apoptosis, foot process effacement and albuminuria. In immortalized mouse podocytes (iMPs), high glucose (HG), silencing RNA (siRNA) or blocking LRP6 (DKK-1) reduced p-LRP6 expression, leading to high GSK3β-p53, p53 expression, apoptosis and increased albumin influx. GSK3β blockade by BIO reduced GSK3β-p53 and podocyte apoptosis. In iMPs under HG, GT reduced apoptosis and the albumin influx by blocking GSK3β-p53 following the rise in p-LRP6 expression. These effects of GT were prevented by LRP6 siRNA or DKK-1. In conclusion, in DM, WNT inhibition, via LRP6, increases GSK3β-p53 and podocyte apoptosis. Maneuvers that inactivate GSK3β-p53, such as GT, may be renoprotective in DM.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Sickle cell retinopathy (SCR) develops in up to 30% of sickle cell disease patients (SCD) during the second decade of life. Treatment for this affection remains palliative, so studies on its pathophysiology may contribute to the future development of novel therapies. SCR is more frequently observed in hemoglobin SC disease and derives from vaso-occlusion in the microvasculature of the retina leading to neovascularization and, eventually, to blindness. Circulating inflammatory cytokines, angiogenic factors, and their interaction may contribute to the pathophysiology of this complication. Angiopoietin (Ang)-1, Ang-2, soluble vascular cell adhesion molecule-1, intercellular adhesion molecule (ICAM)-1, E-selectin, P-selectin, IL1-β, TNF-α, pigment epithelium derived factor (PEDF) and vascular endothelial growth factor plasmatic levels were determined in 37 SCD patients with retinopathy, 34 without retinopathy, and healthy controls. We observed that sICAM-1 is significantly decreased, whereas PEDF is elevated in HbSC patients with retinopathy (P=0.012 and P=0.031, respectively). Ang-1, Ang-2 and IL1-β levels were elevated in SCD patients (P=0.001, P<0.001 and P=0.001, respectively), compared to controls, and HbSS patients presented higher levels of Ang-2 compared to HbSC (P<0.001). Our study supports the possible influence of sICAM-1 and PEDF on the pathophysiology of retinal neovascularization in SCD patients.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

As hypoxia-induced inflammatory angiogenesis may contribute to sickle cell disease manifestations, we compared the angiogenic molecular profiles of plasma from sickle cell disease individuals and correlated these with in vitro endothelial cell-mediated angiogenesis-stimulating activity and in vivo neovascularization. Bioplex demonstrated that plasma from steady-state sickle cell anemia patients presented elevated concentrations of pro-angiogenic factors (Angiopoietin-1, basic fibroblast growth factor, vascular endothelial growth factor, vascular endothelial growth factor-D and placental growth factor) and displayed potent pro-angiogenic activity, significantly augmenting endothelial cell proliferation, migration and capillary-like structure formation. In vivo neovascularization of Matrigel plugs was significantly greater in sickle cell disease mice, compared with non-sickle cell disease mice, consistent with an upregulation of angiogenesis in the disease. In plasma from patients with hemoglobin SC disease without proliferative retinopathy, anti-angiogenic endostatin and thrombospondin-2 were significantly elevated. In contrast, plasma from hemoglobin SC individuals with proliferative retinopathy displayed a pro-angiogenic profile and had more significant effects on endothelial cell proliferation and capillary formation than plasma of patients without retinopathy. Hydroxyurea therapy was associated with significant reductions in plasma angiogenic factor profile, in association with an inhibition of endothelial cell-mediated angiogenic mechanisms and neovascularization. Thus, sickle cell anemia and retinopathic hemoglobin SC individuals present a highly angiogenic circulating milieu, capable of stimulating key endothelial cell-mediated angiogenic mechanisms. Combination anti-angiogenic therapy for preventing progression of unregulated neovascularization and associated manifestations in sickle cell disease, such as pulmonary hypertension, may be indicated; furthermore, the benefits and drawbacks of the potent anti-angiogenic effects of hydroxyurea should be clarified.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study investigated the presence of target bacterial species and the levels of endotoxins in teeth with apical periodontitis. Levels of inflammatory mediators (interleukin [IL]-1β and tumor necrosis factor [TNF]-α) were determined after macrophage stimulation with endodontic content after different phases of endodontic therapy using different irrigants. Thirty primarily infected root canals were randomly assigned into 3 groups according to the irrigant used for root canal preparation (n = 10 per group): GI: 2.5% sodium hypochlorite, GII: 2% chlorhexidine gel, and GIII (control group): saline solution. Root canal samples were taken by using paper points before (s1) and after root canal instrumentation (s2), subsequently to 17% EDTA (s3), after 30 days of intracanal medication (Ca[OH]2 + saline solution) (s4), and before root canal obturation (s5). Polymerase chain reaction (16S recombinant DNA) and limulus amebocyte lysate assay were used for bacterial and endotoxin detection, respectively. Macrophages were stimulated with the root canal contents for IL-1β/TNF-α measurement using enzyme-linked immunosorbent assay. Porphyromonas gingivalis (17/30), Porphyromonas endodontalis (15/30), and Prevotella nigrescens (11/30) were the most prevalent bacterial species. At s1, endotoxins were detected in 100% of the root canals (median = 32.43 EU/mL). In parallel, substantial amounts of IL-1β and TNF-α were produced by endodontic content-stimulated macrophages. At s2, a significant reduction in endotoxin levels was observed in all groups, with GI presenting the greatest reduction (P < .05). After a root canal rinse with EDTA (s3), intracanal medication (s4), and before root canal obturation (s5), endotoxin levels reduced without differences between groups (P < .05). IL-1β and TNF-α release decreased proportionally to the levels of residual endotoxin (P < .05). Regardless of the use of sodium hypochlorite or CHX, the greatest endotoxin reduction occurs after chemomechanical preparation. Increasing steps of root canal therapy associated with intracanal medication enhances endotoxin reduction, leading to a progressively lower activation of proinflammatory cells such as macrophages.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The association between tridimensional scaffolds to cells of interest has provided excellent perspectives for obtaining viable complex tissues in vitro, such as skin, resulting in impressive advances in the field of tissue engineering applied to regenerative therapies. The use of multipotent mesenchymal stromal cells in the treatment of dermo-epidermal wounds is particularly promising due to several relevant properties of these cells, such as high capacity of proliferation in culture, potential of differentiation in multiple skin cell types, important paracrine and immunomodulatory effects, among others. Membranes of chitosan complexed with xanthan may be potentially useful as scaffolds for multipotent mesenchymal stromal cells, given that they present suitable physico-chemical characteristics and have adequate tridimensional structure for the adhesion, growth, and maintenance of cell function. Therefore, the purpose of this work was to assess the applicability of bioactive dressings associating dense and porous chitosan-xanthan membranes to multipotent mesenchymal stromal cells for the treatment of skin wounds. The membranes showed to be non-mutagenic and allowed efficient adhesion and proliferation of the mesenchymal stromal cells in vitro. In vivo assays performed with mesenchymal stromal cells grown on the surface of the dense membranes showed acceleration of wound healing in Wistar rats, thus indicating that the use of this cell-scaffold association for tissue engineering purposes is feasible and attractive.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Vasodilator-stimulated phosphoprotein (VASP) and Zyxin are interacting proteins involved in cellular adhesion and motility. PKA phosphorylates VASP at serine 157, regulating VASP cellular functions. VASP interacts with ABL and is a substrate of the BCR-ABL oncoprotein. The presence of BCR-ABL protein drives oncogenesis in patients with chronic myeloid leukemia (CML) due to a constitutive activation of tyrosine kinase activity. However, the function of VASP and Zyxin in BCR-ABL pathway and the role of VASP in CML cells remain unknown. In vitro experiments using K562 cells showed the involvement of VASP in BCR-ABL signaling. VASP and Zyxin inhibition decreased the expression of anti-apoptotic proteins, BCL2 and BCL-XL. Imatinib induced an increase in phosphorylation at Ser157 of VASP and decreased VASP and BCR-ABL interaction. VASP did not interact with Zyxin in K562 cells; however, after Imatinib treatment, this interaction was restored. Corroborating our data, we demonstrated the absence of phosphorylation at Ser157 in VASP in the bone marrow of CML patients, in contrast to healthy donors. Phosphorylation of VASP on Ser157 was restored in Imatinib responsive patients though not in the resistant patients. Therefore, we herein identified a possible role of VASP in CML pathogenesis, through the regulation of BCR-ABL effector proteins or the absence of phosphorylation at Ser157 in VASP.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Vaso-occlusion, responsible for much of the morbidity of sickle-cell disease, is a complex multicellular process, apparently triggered by leukocyte adhesion to the vessel wall. The microcirculation represents a major site of leukocyte-endothelial interactions and vaso-occlusive processes. We have developed a biochip with subdividing interconnecting microchannels that decrease in size (40 μm to 10 μm in width), for use in conjunction with a precise microfluidic device, to mimic cell flow and adhesion through channels of sizes that approach those of the microcirculation. The biochips were utilized to observe the dynamics of the passage of neutrophils and red blood cells, isolated from healthy and sickle-cell anemia (SCA) individuals, through laminin or endothelial adhesion molecule-coated microchannels at physiologically relevant rates of flow and shear stress. Obstruction of E-selectin/intercellular adhesion molecule 1-coated biochip microchannels by SCA neutrophils was significantly greater than that observed for healthy neutrophils, particularly in the microchannels of 40-15 μm in width. Whereas SCA red blood cells alone did not significantly adhere to, or obstruct, microchannels, mixed suspensions of SCA neutrophils and red blood cells significantly adhered to and obstructed laminin-coated channels. Results from this in vitro microfluidic model support a primary role for leukocytes in the initiation of SCA occlusive processes in the microcirculation. This assay represents an easy-to-use and reproducible in vitro technique for understanding molecular mechanisms and cellular interactions occurring in subdividing microchannels of widths approaching those observed in the microvasculature. The assay could hold potential for testing drugs developed to inhibit occlusive mechanisms such as those observed in SCA and thrombotic diseases.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cecropia glaziovii is a tree with used in Brazilian popular medicine. Methods allowing the clonal propagation of this species are of great interest for superior genotype multiplication and perpetuation. For this reason, we examined the effect of different culture media and different types of explants on adventitious shoot regeneration from callus and buds of C. glaziovii. Leaves, petioles and stipules obtained from aseptically grown seedlings or from pre-sterilized plants were used to initiate cultures. Adventitious shoot regeneration was achieved when apical and axillary buds were inoculated on gelled Murashige & Skoog (MS) medium supplemented with 6-benzylaminopurine alone (BAP) (1.0, 5.0 or 10.0 mg L-1) or combined with -naphthalene acetic acid (NAA) (1.0 or 2.0 mg L-1), after 40 days of culture. Best callus production was obtained after 30 days of petioles' culture on gelled MS medium with 2,4 dichlorophenoxyacetic acid (2,4-D) (5.0 mg L-1) combined with BAP (1.0 mg L-1). Successful shoot regeneration from callus was achieved when MS medium supplemented with zeatin (ZEA) (0.1 mg L-1) alone or combined with 2,4-D (1.0 or 5.0 mg L-1) was inoculated with friable callus obtained from petioles. All shoots were rooted by inoculation on MS medium supplemented with indole-3-acetic acid (IAA) (1.0 mg L-1). Rooted plants transferred to potting soil were successfully established. All in vitro regenerated plantlets showed to be normal, without morphological variations, being also identical to the source plant. Our study has shown that C. glaziovii can be propagated by tissue culture methods, allowing large scale multiplication of superior plants for pharmacological purposes.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.