32 resultados para Structural damage detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

To characterize cumulative joint damage (CJD) patterns in rheumatoid arthritis (RA) and determine their associations with demographic/clinical features and HLA-DRB1 gene polymorphism. Hand and foot radiographs were obtained from 404 patients with RA. CJD patterns were determined by 3 derivations from Sharp/van der Heijde scores, obtained by the mathematical division of scores for hands/feet (Sharp-h/f score), fingers/wrists (Sharp-f/w score), and erosion/space narrowing (Sharp-e/sn score), respectively. DNA and serum were obtained for determination of HLA-DRB1 polymorphism, rheumatoid factor (RF), and anticitrullinated protein antibodies (ACPA). Patients with wrist-dominant CJD pattern were more likely to have severe RA than those with finger-dominant pattern (68.4% vs 46.0%; p = 0.036) as were those with foot-dominant vs hand-dominant CJD pattern (76.5% vs 56.4%; p = 0.044). HLA-DRB1 shared epitope (SE) alleles were associated with erosion-dominant CJD pattern (p = 0.021). Patients with erosion-dominant CJD pattern had higher levels of RF and ACPA than those with space-narrowing-dominant CJD pattern (median RF 71.35 U/ml vs 22.05 U/ml, respectively; p = 0.003; median ACPA 187.9 U/ml vs 143.2 U/ml, respectively; p < 0.001). The majority of triple-positive patients (SE+, RF+, ACPA+) had erosion-dominant CJD pattern (62.3%) while the majority of triple-negative patients (SE-, FR-, ACPA-) had space narrowing-dominant CJD pattern (75%; p = 0.017). ACPA was associated with HLA-DRB1 SE alleles (p < 0.05). Patients with foot-dominant CJD pattern were taller than those with hand-dominant CJD pattern (p = 0.002); those with erosion-dominant CJD pattern had higher weight and body mass index than those with space narrowing-dominant CJD pattern (p = 0.014, p = 0.001). CJD patterns were associated with disease severity, HLA-DRB1 SE status, presence and titer of ACPA and RF, and morphometric features.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate the microscopic structure and chemical composition of titanium bone plates and screws retrieved from patients with a clinical indication and to relate the results to the clinical conditions associated with the removal of these devices. Osteosynthesis plates and screws retrieved from 30 patients between January 2010 and September 2013 were studied by metallographic, gas, and energy dispersive X-ray (EDX) analyses and the medical records of these patients were reviewed. Forty-eight plates and 238 screws were retrieved. The time elapsed between plate and screw insertion and removal ranged between 11 days and 10 years. Metallographic analysis revealed that all the plates were manufactured from commercially pure titanium (CP-Ti). The screw samples analyzed consisted of Ti-6Al-4V alloy, except four samples, which consisted of CP-Ti. Titanium plates studied by EDX analysis presented greater than 99.7% titanium by mass. On gas analysis of Ti-6Al-4V screws, three samples were outside the standard values. One CP-Ti screw sample and one plate sample also presented an oxygen analysis value above the standard. The results indicated that the physical properties and chemical compositions of the plates and screws did not correspond with the need to remove these devices or the time of retention.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The development of technological routes to convert lignocellulosic biomass to liquid fuels requires an in-depth understanding of the cell wall architecture of substrates. Essential pretreatment processes are conducted to reduce biomass recalcitrance and usually increase the reactive surface area. Quantitative three-dimensional information about both bulk and surface structural features of substrates needs to be obtained to expand our knowledge of substrates. In this work, phase-contrast tomography (PCT) was used to gather information about the structure of a model lignocellulosic biomass (piassava fibers). The three-dimensional cellular organization of piassava fibers was characterized by PCT using synchrotron radiation. This technique enabled important physical features that describe the substrate piassava fibers to be visualized and quantified. The external surface area of a fiber and internal surface area of the pores in a fiber could be determined separately. More than 96% of the overall surface area available to enzymes was in the bulk substrate. The pore surface area and length exhibited a positive linear relationship, where the slope of this relationship depended on the plant tissue. We demonstrated that PCT is a powerful tool for the three-dimensional characterization of the cell wall features related to biomass recalcitrance. Original and relevant quantitative information about the structural features of the analyzed material were obtained. The data obtained by PCT can be used to improve processing routes to efficiently convert biomass feedstock into sugars.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Machado-Joseph disease (MJD/SCA3) is the most frequent spinocerebellar ataxia, characterized by brainstem, basal ganglia and cerebellar damage. Few magnetic resonance imaging based studies have investigated damage in the cerebral cortex. The objective was to determine whether patients with MJD/SCA3 have cerebral cortex atrophy, to identify regions more susceptible to damage and to look for the clinical and neuropsychological correlates of such lesions. Forty-nine patients with MJD/SCA3 (mean age 47.7 ± 13.0 years, 27 men) and 49 matched healthy controls were enrolled. All subjects underwent magnetic resonance imaging scans in a 3 T device, and three-dimensional T1 images were used for volumetric analyses. Measurement of cortical thickness and volume was performed using the FreeSurfer software. Groups were compared using ancova with age, gender and estimated intracranial volume as covariates, and a general linear model was used to assess correlations between atrophy and clinical variables. Mean CAG expansion, Scale for Assessment and Rating of Ataxia (SARA) score and age at onset were 72.1 ± 4.2, 14.7 ± 7.3 and 37.5 ± 12.5 years, respectively. The main findings were (i) bilateral paracentral cortex atrophy, as well as the caudal middle frontal gyrus, superior and transverse temporal gyri, and lateral occipital cortex in the left hemisphere and supramarginal gyrus in the right hemisphere; (ii) volumetric reduction of basal ganglia and hippocampi; (iii) a significant correlation between SARA and brainstem and precentral gyrus atrophy. Furthermore, some of the affected cortical regions showed significant correlations with neuropsychological data. Patients with MJD/SCA3 have widespread cortical and subcortical atrophy. These structural findings correlate with clinical manifestations of the disease, which support the concept that cognitive/motor impairment and cerebral damage are related in disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Machado-Joseph disease (SCA3) is the most frequent spinocerebellar ataxia worldwide and characterized by remarkable phenotypic heterogeneity. MRI-based studies in SCA3 focused in the cerebellum and connections, but little is known about cord damage in the disease and its clinical relevance. To evaluate the spinal cord damage in SCA3 through quantitative analysis of MRI scans. A group of 48 patients with SCA3 and 48 age and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images to estimate the cervical spinal cord area (CA) and eccentricity (CE) at three C2/C3 levels based on a semi-automatic image segmentation protocol. The scale for assessment and rating of ataxia (SARA) was employed to quantify disease severity. The two groups-SCA3 and controls-were significantly different regarding CA (49.5 ± 7.3 vs 67.2 ± 6.3 mm(2), p < 0.001) and CE values (0.79 ± 0.06 vs 0.75 ± 0.05, p = 0.005). In addition, CA presented a significant correlation with SARA scores in the patient group (p = 0.010). CE was not associated with SARA scores (p = 0.857). In the multiple variable regression, we found that disease duration was the only variable associated with CA (coefficient = -0.629, p = 0.025). SCA3 is characterized by cervical cord atrophy and antero-posterior flattening. In addition, the spinal cord areas did correlate with disease severity. This suggests that quantitative analyses of the spinal cord MRI might be a useful biomarker in SCA3.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We review here the chemistry of reactive oxygen and nitrogen species, their biological sources and targets; particularly, biomolecules implicated in the redox balance of the human blood, and appraise the analytical methods available for their detection and quantification. Those biomolecules are represented by the enzymatic antioxidant defense machinery, whereas coadjutant reducing protection is provided by several low molecular weight molecules. Biomolecules can be injured by RONS yielding a large repertoire of oxidized products, some of which can be taken as biomarkers of oxidative damage. Their reliable determination is of utmost interest for their potentiality in diagnosis, prevention and treatment of maladies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Chromatography combined with several different detection systems is one of the more used and better performing analytical tools. Chromatography with tandem mass spectrometric detection gives highly selective and sensitive analyses and permits obtaining structural information about the analites and about their molar masses. Due to these characteristics, this analytical technique is very efficient when used to detect substances at trace levels in complex matrices. In this paper we review instrumental and technical aspects of chromatography-tandem mass spectrometry and the state of the art of the technique as it is applied to analysis of toxic substances in food.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Losses of horticulture product in Brazil are significant and among the main causes are the use of inappropriate boxes and the absence of a cold chain. A project for boxes is proposed, based on computer simulations, optimization and experimental validation, trying to minimize the amount of wood associated with structural and ergonomic aspects and the effective area of the openings. Three box prototypes were designed and built using straight laths with different configurations and areas of openings (54% and 36%). The cooling efficiency of Tommy Atkins mango (Mangifera Indica L.) was evaluated by determining the cooling time for fruit packed in the wood models and packed in the commercially used cardboard boxes, submitted to cooling in a forced-air system, at a temperature of 6ºC and average relative humidity of 85.4±2.1%. The Finite Element Method was applied, for the dimensioning and structural optimization of the model with the best behavior in relation to cooling. All wooden boxes with fruit underwent vibration testing for two hours (20 Hz). There was no significant difference in average cooling time in the wooden boxes (36.08±1.44 min); however, the difference was significant in comparison to the cardboard boxes (82.63±29.64 min). In the model chosen for structural optimization (36% effective area of openings and two side laths), the reduction in total volume of material was 60% and 83% in the cross section of the columns. There was no indication of mechanical damage in the fruit after undergoing the vibration test. Computer simulations and structural study may be used as a support tool for developing projects for boxes, with geometric, ergonomic and thermal criteria.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.