23 resultados para Spoken term detection
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
The aim of this study was to evaluate the differential sensitivity of sugarcane genotypes to H2O2 in root medium. As a hypothesis, the drought tolerant genotype would be able to minimize the oxidative damage and maintain the water transport from roots to shoots, reducing the negative effects on photosynthesis. The sugarcane genotypes IACSP94-2094 (drought tolerant) and IACSP94-2101 (drought sensitive) were grown in a growth chamber and exposed to three levels of H2O2 in nutrient solution: control; 3mmolL(-1) and 80mmolL(-1). Leaf gas exchange, photochemical activity, root hydraulic conductance (Lr) and antioxidant metabolism in both roots and leaves were evaluated after 15min of treatment with H2O2. Although, root hydraulic conductance, stomatal aperture, apparent electron transport rate and instantaneous carboxylation efficiency have been reduced by H2O2 in both genotypes, IACSP94-2094 presented higher values of those variables as compared to IACSP94-2101. There was a significant genotypic variation in relation to the physiological responses of sugarcane to increasing H2O2 in root tissues, being root changes associated with modifications in plant shoots. IACSP94-2094 presented a root antioxidant system more effective against H2O2 in root medium, regardless H2O2 concentration. Under low H2O2 concentration, water transport and leaf gas exchange of IACSP94-2094 were less affected as compared to IACSP94-2101. Under high H2O2 concentration, the lower sensitivity of IACSP94-2094 was associated with increases in superoxide dismutase activity in roots and leaves and increases in catalase activity in roots. In conclusion, we propose a general model of sugarcane reaction to H2O2, linking root and shoot physiological responses.
Resumo:
Diagnostic imaging techniques play an important role in assessing the exact location, cause, and extent of a nerve lesion, thus allowing clinicians to diagnose and manage more effectively a variety of pathological conditions, such as entrapment syndromes, traumatic injuries, and space-occupying lesions. Ultrasound and nuclear magnetic resonance imaging are becoming useful methods for this purpose, but they still lack spatial resolution. In this regard, recent phase contrast x-ray imaging experiments of peripheral nerve allowed the visualization of each nerve fiber surrounded by its myelin sheath as clearly as optical microscopy. In the present study, we attempted to produce high-resolution x-ray phase contrast images of a human sciatic nerve by using synchrotron radiation propagation-based imaging. The images showed high contrast and high spatial resolution, allowing clear identification of each fascicle structure and surrounding connective tissue. The outstanding result is the detection of such structures by phase contrast x-ray tomography of a thick human sciatic nerve section. This may further enable the identification of diverse pathological patterns, such as Wallerian degeneration, hypertrophic neuropathy, inflammatory infiltration, leprosy neuropathy and amyloid deposits. To the best of our knowledge, this is the first successful phase contrast x-ray imaging experiment of a human peripheral nerve sample. Our long-term goal is to develop peripheral nerve imaging methods that could supersede biopsy procedures.
Resumo:
Atmospheric carbon dioxide records indicate that the land surface has acted as a strong global carbon sink over recent decades, with a substantial fraction of this sink probably located in the tropics, particularly in the Amazon. Nevertheless, it is unclear how the terrestrial carbon sink will evolve as climate and atmospheric composition continue to change. Here we analyse the historical evolution of the biomass dynamics of the Amazon rainforest over three decades using a distributed network of 321 plots. While this analysis confirms that Amazon forests have acted as a long-term net biomass sink, we find a long-term decreasing trend of carbon accumulation. Rates of net increase in above-ground biomass declined by one-third during the past decade compared to the 1990s. This is a consequence of growth rate increases levelling off recently, while biomass mortality persistently increased throughout, leading to a shortening of carbon residence times. Potential drivers for the mortality increase include greater climate variability, and feedbacks of faster growth on mortality, resulting in shortened tree longevity. The observed decline of the Amazon sink diverges markedly from the recent increase in terrestrial carbon uptake at the global scale, and is contrary to expectations based on models.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant hereditary cancer syndrome characterized mostly by parathyroid, enteropancreatic, and anterior pituitary tumors. We present a case of an 8-year-old boy referred because of hypoglycemic attacks. His diagnosis was pancreatic insulinoma. Paternal grandmother died due to repeated gastroduodenal ulcerations and a paternal aunt presented similar manifestations. At a first evaluation, the father presented only gastric ulceration but subsequently developed hyperparathyroidism and lung carcinoid tumor. During almost 15 years of follow-up, three brothers and the index case presented hyperparathyroidism and hyperprolactinemia. Molecular study showed a G to A substitution in intron 4, at nine nucleotides upstream of the splicing acceptor site, causing a splicing mutation. All affected members of the family have the same mutation. Paternal grandmother and aunt were not studied and the mother does not carry any mutation. MEN1 is a rare condition that requires permanent medical assistance. Early clinical and genetic identification of affected individuals is essential for their own surveillance and also for genetic counseling.
Resumo:
PURPOSE: To determine the mean critical fusion frequency and the short-term fluctuation, to analyze the influence of age, gender, and the learning effect in healthy subjects undergoing flicker perimetry. METHODS: Study 1 - 95 healthy subjects underwent flicker perimetry once in one eye. Mean critical fusion frequency values were compared between genders, and the influence of age was evaluated using linear regression analysis. Study 2 - 20 healthy subjects underwent flicker perimetry 5 times in one eye. The first 3 sessions were separated by an interval of 1 to 30 days, whereas the last 3 sessions were performed within the same day. The first 3 sessions were used to investigate the presence of a learning effect, whereas the last 3 tests were used to calculate short-term fluctuation. RESULTS: Study 1 - Linear regression analysis demonstrated that mean global, foveal, central, and critical fusion frequency per quadrant significantly decreased with age (p<0.05).There were no statistically significant differences in mean critical fusion frequency values between males and females (p>0.05), with the exception of the central area and inferonasal quadrant (p=0.049 and p=0.011, respectively), where the values were lower in females. Study 2 - Mean global (p=0.014), central (p=0.008), and peripheral (p=0.03) critical fusion frequency were significantly lower in the first session compared to the second and third sessions. The mean global short-term fluctuation was 5.06±1.13 Hz, the mean interindividual and intraindividual variabilities were 11.2±2.8% and 6.4±1.5%, respectively. CONCLUSION: This study suggests that, in healthy subjects, critical fusion frequency decreases with age, that flicker perimetry is associated with a learning effect, and that a moderately high short-term fluctuation is expected.