Modelos de transferência de metal pesado na cana-de-açúcar adubada com composto de lixo urbano

The research approaches recycling of urban waste compost (UWC) as an alternative fertilizer for sugarcane crop and as a social and environmental solution to the solids residuals growth in urban centers. A mathematical model was used in order to know the metal dynamics as decision support tool, aiming to establish of criteria and procedures for UWC's safe use, limited by the amount of heavy metal. A compartmental model was developed from experimental data in controlled conditions and partially checked with field data. This model described the heavy metal transference in the system soil-root-aerial portion of sugarcane plants and concluded that nickel was metal to be concern, since it takes approximately three years to be attenuated in the soil, reaching the aerial portions of the plant at high concentrations. Regarding factors such as clay content, oxide level and soil pH, it was observed that for soil with higher buffering capacity, the transfer of the majority of the metals was slower. This model may become an important tool for the attainment of laws regarding the UWC use, aiming to reduce environment contamination the waste accumulation and production costs.

Morfoanatomia da raiz tuberosa de Vernonia oxylepis Sch. Bip. in Mart. ex Baker - Asteraceae

Several native herbaceous and subshrub species native to the Cerrado in Brazil are geophytes, that is, they survive the unfavorable dry season and low temperatures, that sometimes coincide with fire, with only the underground system intact. Vernonia oxylepis is one of these species and the aim of this study was to describe the morpho-anatomy of the tuberous root and bud formation on this structure. The main axis of this root is perpendicular to the soil surface, and from which aerial shoots arise periodically throughout the life cycle. On the upper portion of the root, self-grafting of the shoots occurs. The root stores lipids and fructans, exhibits contraction and produces reparatory buds; adventitious buds arise from proliferated pericycle. These characteristics may be related to adaptation of this species to conditions in the Cerrado.

Germinação de Ternstroemia brasiliensis Cambess. (Pentaphylacaceae) de floresta de restinga

The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Imigrantes bolivianos em São Paulo : a Praça Kantuta e o futebol

Universidade Estadual de Campinas . Faculdade de Educação Física