Fracture Of Distal Humerus: Mipo Technique With Visualization Of The Radial Nerve.

To evaluate the outcomes in patients treated for humerus distal third fractures with MIPO technique and visualization of the radial nerve by an accessory approach, in those without radial palsy before surgery. The patients were treated with MIPO technique. The visualization and isolation of the radial nerve was done by an approach between the brachialis and the brachiorradialis, with an oblique incision, in the lateral side of the arm. MEPS was used to evaluate the elbow function. Seven patients were evaluated with a mean age of 29.8 years old. The average follow up was 29.85 months. The radial neuropraxis after surgery occurred in three patients. The sensorial recovery occurred after 3.16 months on average and also of the motor function, after 5.33 months on average, in all patients. We achieved fracture consolidation in all patients (M=4.22 months). The averages for flexion-extension and prono-supination were 112.85° and 145°, respectively. The MEPS average score was 86.42. There was no case of infection. This approach allowed excluding a radial nerve interposition on site of the fracture and/or under the plate, showing a high level of consolidation of the fracture and a good evolution of the range of movement of the elbow. Level of Evidence IV, Case Series.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

In Vitro Effects Of Hydrogen Peroxide Combined With Different Activators For The In-office Bleaching Technique On Enamel.

Abstract Objective. The aim of this study was to evaluate the alteration of human enamel bleached with high concentrations of hydrogen peroxide associated with different activators. Materials and methods. Fifty enamel/dentin blocks (4 × 4 mm) were obtained from human third molars and randomized divided according to the bleaching procedure (n = 10): G1 = 35% hydrogen peroxide (HP - Whiteness HP Maxx); G2 = HP + Halogen lamp (HL); G3 = HP + 7% sodium bicarbonate (SB); G4 = HP + 20% sodium hydroxide (SH); and G5 = 38% hydrogen peroxide (OXB - Opalescence Xtra Boost). The bleaching treatments were performed in three sessions with a 7-day interval between them. The enamel content, before (baseline) and after bleaching, was determined using an FT-Raman spectrometer and was based on the concentration of phosphate, carbonate, and organic matrix. Statistical analysis was performed using two-way ANOVA for repeated measures and Tukey's test. Results. The results showed no significant differences between time of analysis (p = 0.5175) for most treatments and peak areas analyzed; and among bleaching treatments (p = 0.4184). The comparisons during and after bleaching revealed a significant difference in the HP group for the peak areas of carbonate and organic matrix, and for the organic matrix in OXB and HP+SH groups. Tukey's analysis determined that the difference, peak areas, and the interaction among treatment, time and peak was statistically significant (p < 0.05). Conclusion. The association of activators with hydrogen peroxide was effective in the alteration of enamel, mainly with regards to the organic matrix.

Preservation Of The External Jugular Vein In Bilateral Radical Neck Dissections: Technique In Two Cases And Review Of The Literature.

Context. The possibility of cephalic venous hypertension with the resultant facial edema and elevated cerebrospinal fluid pressure continues to challenge head and neck surgeons who perform bilateral radical neck dissections during simultaneous or staged procedures. Case Report. The staged procedure in patients who require bilateral neck dissections allows collateral venous drainage to develop, mainly through the internal and external vertebral plexuses, thereby minimizing the risks of deleterious consequences. Nevertheless, this procedure has disadvantages, such as a delay in definitive therapy, the need for a second hospitalization and anesthesia, and the risk of cutting lymphatic vessels and spreading viable cancer cells. In this paper, we discuss the rationale and feasibility of preserving the external jugular vein. Considering the limited number of similar reports in the literature, two cases in which this procedure was accomplished are described. The relevant anatomy and technique are reviewed and the patients' outcomes are discussed. Conclusion. Preservation of the EJV during bilateral neck dissections is technically feasible, fast, and safe, with clinically and radiologically demonstrated patency.

In Vivo Evaluation Of The Genetic Toxicity Of Rubus Niveus Thunb. (rosaceae) Extract And Initial Screening Of Its Potential Chemoprevention Against Doxorubicin-induced Dna Damage.

Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.

Microsatellite Markers For Urochloa Humidicola (poaceae) And Their Transferability To Other Urochloa Species.

Urochloa humidicola is a warm-season grass commonly used as forage in the tropics and is recognized for its tolerance to seasonal flooding. This grass is an important forage species for the Cerrado and Amazon regions of Brazil. U. humidicola is a polyploid species with variable ploidy (6X-9X) and facultative apomixis with high phenotypic plasticity. However, this apomixis and ploidy, as well as the limited knowledge of the genetic basis of the germplasm collection, have constrained genetic breeding activities, yet microsatellite markers may enable a better understanding of the species' genetic composition. This study aimed to develop and characterize new polymorphic microsatellite molecular markers in U. humidicola and to evaluate their transferability to other Urochloa species. A set of microsatellite markers for U. humidicola was identified from two new enriched genomic DNA libraries: the first library was constructed from a single sexual genotype and the second from a pool of eight apomictic genotypes selected on the basis of previous results. Of the 114 loci developed, 72 primer pairs presented a good amplification product, and 64 were polymorphic among the 34 genotypes tested. The number of bands per simple sequence repeat (SSR) locus ranged from 1 to 29, with a mean of 9.6 bands per locus. The mean polymorphism information content (PIC) of all loci was 0.77, and the mean discrimination power (DP) was 0.87. STRUCTURE analysis revealed differences among U. humidicola accessions, hybrids, and other Urochloa accessions. The transferability of these microsatellites was evaluated in four species of the genus, U. brizantha, U. decumbens, U. ruziziensis, and U. dictyoneura, and the percentage of transferability ranged from 58.33% to 69.44% depending on the species. This work reports new polymorphic microsatellite markers for U. humidicola that can be used for breeding programs of this and other Urochloa species, including genetic linkage mapping, quantitative trait loci identification, and marker-assisted selection.

New Interaction Partners For Nek4.1 And Nek4.2 Isoforms: From The Dna Damage Response To Rna Splicing.

Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.

High Prevalence Of Insulin Resistance Assessed By The Glucose Clamp Technique In Hormonal And Non-hormonal Contraceptive Users.

Objective To assess the prevalence of insulin resistance (IR) and associated factors in contraceptive users. Methods A total of 47 women 18 to 40 years of age with a body mass index (kg/m(2)) < 30, fasting glucose levels < 100 mg/dl and 2-hour glucose level < 140 mg/dl after a 75-g oral glucose load were submitted to a hyperinsulinemic-euglycemic clamp. The women were distributed in tertiles regarding M-values. The analysed variables were use of combined hormonal/non-hormonal contraception, duration of use, body composition, lipid profile, glucose levels and blood pressure. Results IR was detected in 19% of the participants. The women with low M-values presented significantly higher body fat mass, waist-to-hip ratio, fasting insulin, HOMA-IR and were nulligravida, showed > 1 year of contraceptive use and higher triglyceride levels. IR was more frequent among combined oral contraceptive users, however no association was observed after regression analysis. Conclusions The prevalence of IR was high among healthy women attending a family planning clinic independent of the contraceptive method used with possible long-term negative consequences regarding their metabolic and cardiovascular health. Although an association between hormonal contraception and IR could not be found this needs further research. Family planning professionals should be proactive counselling healthy women about the importance of healthy habits.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.