Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Ethanol Modulates The Synthesis And Catabolism Of Retinoic Acid In The Rat Prostate.

All-trans retinoic acid (atRA) maintains physiological stability of the prostate, and we reported that ethanol intake increases atRA in the rat prostate; however the mechanisms underlying these changes are unknown. We evaluated the impact of a low- and high-dose ethanol intake (UChA and UChB strains) on atRA metabolism in the dorsal and lateral prostate. Aldehyde dehydrogenase (ALDH) subtype 1A3 was increased in the dorsal prostate of UChA animals while ALDH1A1 and ALDH1A2 decreased in the lateral prostate. In UChB animals, ALDH1A1, ALDH1A2, and ALDH1A3 increased in the dorsal prostate, and ALDH1A3 decreased in the lateral prostate. atRA levels increased with the low activity of CYP2E1 and decreased with high CYP26 activity in the UChB dorsal prostate. Conversely, atRA was found to decrease when the activity of total CYP was increased in the UChA lateral prostate. Ethanol modulates the synthesis and catabolism of atRA in the prostate in a concentration-dependent manner.

Burden Of Focal Cryoablation Versus Brachytherapy Versus Active Surveillance In The Treatment Of Very Low-risk Prostate Cancer: A Preliminary Head-to-head Comprehensive Assessment.

Focal cryoablation (FC), brachytherapy (B) and active surveillance (AS) were offered to patients diagnosed with very low-risk prostate cancer (VLRPC) in an equal access protocol. Comprehensive validated self-report questionnaires accessed patients' erectile (IIEF-5) and voiding (IPSS) functions, Beck scales measured anxiety (BAI), hopelessness (BHS) and depression (BDI), SF-36 reflected patients' quality of life added to the emotional thermometers including five visual analogue scales (distress, anxiety, depression, anger and need for help). Kruskal-Wallis or ANOVA tests and Spearman's correlations were obtained among groups and studied variables. Thirty patients were included, median follow-up 18 months (15-21). Those on AS (n = 11) were older, presented higher hopelessness (BHS) and lower general health perceptions (SF-36) scores than patients opting for FC (n = 10) and B (n = 9), P = 0.0014, P = 0.0268 and P = 0.0168 respectively. Patients on B had higher IPSS scores compared to those under FC and AC, P = 0.0223. For all 30 included patients, Spearman's correlation (rs ) was very strong between BHS and general health perceptions (rs  = -0.800, P < 0.0001), and weak/moderate between age and BHS (rs  = 0.405, P = 0.026) and age and general health perceptions (rs  = -0.564, P = 0.001). The sample power was >60%. To be considered in patients' counselling and care, current study supports the hypothesis that even VLRPC when untreated undermines psychosocial domains.

The Effects Of High Doses Of Nandrolone Decanoate And Exercise On Prostate Microvasculature Of Adult And Older Rats.

The present study aimed to investigate the effects of the interaction between the abusive use of nandrolone decanoate (ND) and physical activity on the prostate structure of adult and older rats. We evaluated whether the use of ND, associated or not with physical exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate. Fifty-six male Sprague-Dawley rats were divided into eight groups. The animals were treated for eight weeks and divided into sedentary and trained groups, with or without ND use. Four groups were sacrificed 48 h after the end of the eight week experiment (adult groups), and four other groups were sacrificed at 300 days of age (older groups). The prostate was collected and processed for stereological and histopathological analysis and for the expression of AQP1 and VEGF by the Western blotting technique. Both ND and physical activity altered the ventral prostate structure of the rats; the AQP1 and VEGF expression increased in young animals subjected to physical exercise. Thus, it was concluded that the use of ND, associated or not with exercise during the post-pubertal stage, interferes with the morphophysiology of the prostate.

Androgen Therapy Reverses Injuries Caused By Ethanol Consumption In The Prostate: Testosterone As A Possible Target To Ethanol-related Disorders.

Chronic ethanol consumption leads to reproductive damages, since it can act directly in the tissues or indirectly, causing a hormonal imbalance. Prostate is a hormone-dependent gland and, consequently, susceptible to ethanol. The potential of testosterone therapy in the ethanol-related disorders was investigated in the prostate microenvironment. UChB rats aged 90 days were divided into 2 experimental groups (n=20): C: drinking water only and EtOH: drinking 10% (v/v) ethanol at >2 g/kg body weight/day+water. At 150 days old, 10 rats from each group received subcutaneous injections of testosterone cypionate (5 mg/kg body weight) diluted in corn oil every other day for 4 weeks, constituting T and EtOH+T, while the remaining animals received corn oil as vehicle. Animals were euthanized at 180 days old, by decapitation. Blood was collected to obtain hormone concentrations and ventral prostate was dissected and processed for light microscope and molecular analyses. Ventral prostate weight, plasma testosterone and DHT and intraprostatic testosterone concentrations were increased after testosterone treatment. Plasma estradiol level was reduced in the EtOH+T. Inflammatory foci, metaplasia and epithelial atrophy were constantly found in the prostate of EtOH and were not observed after hormonal therapy. No differences were found in the expression of AR, ERβ and DACH-1. Additionally, testosterone treatment down-regulated ERα and increased the e-cadherin and α-actinin immunoreactivities. Testosterone was able to reverse damages caused by ethanol consumption in the prostate microenvironment and becomes a possible target to be investigated to ethanol-related disorders.

Key Participants Of The Tumor Microenvironment Of The Prostate: An Approach Of The Structural Dynamic Of Cellular Elements And Extracellular Matrix Components During Epithelial-stromal Transition.

Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.