Interaction Between Fiscal And Monetary Policy In A Dynamic Nonlinear Model.

The objective of this study is to verify the dynamics between fiscal policy, measured by public debt, and monetary policy, measured by a reaction function of a central bank. Changes in monetary policies due to deviations from their targets always generate fiscal impacts. We examine two policy reaction functions: the first related to inflation targets and the second related to economic growth targets. We find that the condition for stable equilibrium is more restrictive in the first case than in the second. We then apply our simulation model to Brazil and United Kingdom and find that the equilibrium is unstable in the Brazilian case but stable in the UK case.

Imatinib Restores Vasp Activity And Its Interaction With Zyxin In Bcr-abl Leukemic Cells.

Vasodilator-stimulated phosphoprotein (VASP) and Zyxin are interacting proteins involved in cellular adhesion and motility. PKA phosphorylates VASP at serine 157, regulating VASP cellular functions. VASP interacts with ABL and is a substrate of the BCR-ABL oncoprotein. The presence of BCR-ABL protein drives oncogenesis in patients with chronic myeloid leukemia (CML) due to a constitutive activation of tyrosine kinase activity. However, the function of VASP and Zyxin in BCR-ABL pathway and the role of VASP in CML cells remain unknown. In vitro experiments using K562 cells showed the involvement of VASP in BCR-ABL signaling. VASP and Zyxin inhibition decreased the expression of anti-apoptotic proteins, BCL2 and BCL-XL. Imatinib induced an increase in phosphorylation at Ser157 of VASP and decreased VASP and BCR-ABL interaction. VASP did not interact with Zyxin in K562 cells; however, after Imatinib treatment, this interaction was restored. Corroborating our data, we demonstrated the absence of phosphorylation at Ser157 in VASP in the bone marrow of CML patients, in contrast to healthy donors. Phosphorylation of VASP on Ser157 was restored in Imatinib responsive patients though not in the resistant patients. Therefore, we herein identified a possible role of VASP in CML pathogenesis, through the regulation of BCR-ABL effector proteins or the absence of phosphorylation at Ser157 in VASP.

Two mistletoes are too many?: Interspecific occurrence of mistletoes on the same host tree

Mistletoe can have a major impact on the fitness of the host plant. If there is more than one species of mistletoe on the same host tree, the overall impact might be amplified. We report the occurrence of more than one species of mistletoe on the same host tree. Although it is not a rule in the field, to our knowledge, there have been no studies of this topic. In most cases, two species of mistletoe were recorded on the same host tree, although we recorded three species of mistletoe on one occasion. This demonstrates that different species of mistletoe can be compatible with the same host species. Therefore, compatibility (structural and physiological) might be an important factor for the occurrence of mistletoe. Recent studies have shown that if the mistletoe does not recognize the host species, the deposited seeds will germinate but the haustorium will not penetrate the host branch. This is probably the primary mechanism in the establishment of more than one species of mistletoe on the same host, which can trigger a cascade of harmful effects for the host species.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.