Breaking Oil-in-water Emulsions Stabilized By Yeast.

Several biotechnological processes can show an undesirable formation of emulsions making difficult phase separation and product recovery. The breakup of oil-in-water emulsions stabilized by yeast was studied using different physical and chemical methods. These emulsions were composed by deionized water, hexadecane and commercial yeast (Saccharomyces cerevisiae). The stability of the emulsions was evaluated varying the yeast concentration from 7.47 to 22.11% (w/w) and the phases obtained after gravity separation were evaluated on chemical composition, droplet size distribution, rheological behavior and optical microscopy. The cream phase showed kinetic stability attributed to mechanisms as electrostatic repulsion between the droplets, a possible Pickering-type stabilization and the viscoelastic properties of the concentrated emulsion. Oil recovery from cream phase was performed using gravity separation, centrifugation, heating and addition of demulsifier agents (alcohols and magnetic nanoparticles). Long centrifugation time and high centrifugal forces (2h/150,000×g) were necessary to obtain a complete oil recovery. The heat treatment (60°C) was not enough to promote a satisfactory oil separation. Addition of alcohols followed by centrifugation enhanced oil recovery: butanol addition allowed almost complete phase separation of the emulsion while ethanol addition resulted in 84% of oil recovery. Implementation of this method, however, would require additional steps for solvent separation. Addition of charged magnetic nanoparticles was effective by interacting electrostatically with the interface, resulting in emulsion destabilization under a magnetic field. This method reached almost 96% of oil recovery and it was potentially advantageous since no additional steps might be necessary for further purifying the recovered oil.

Effect Of Calendula Officinalis Cream On Achilles Tendon Healing.

In recent years, the scientific community has undertaken research on plant extracts, searching for compounds with pharmacological activities that can be used in diverse fields of medicine. Calendula officinalis L. is known to have antioxidant, anti-inflammatory, antibacterial, and wound healing properties when used to treat skin burns. Therefore, the purpose of this study was to analyze the effects of C. officinalis on the initial phase of Achilles tendon healing. Wistar rats were separated in three groups: Calendula (Cal)-rats with a transected tendon were treated with topical applications of C. officinalis cream and then euthanized 7 days after injury; Control (C)-rats were treated with only vehicle after transection; and Normal (N)-rats without tenotomy. Higher concentrations of hydroxyproline (an indicator of total collagen) and non-collagenous proteins were observed in the Cal group in relation to the C group. Zymography showed no difference in the amount of the isoforms of metalloproteinase-2 and of metalloproteinase-9, between C and Cal groups. Polarization microscopy images analysis showed that the Cal group presented a slightly higher birefringence compared with the C group. In sections of tendons stained with toluidine blue, the transected groups presented higher metachromasy as compared with the N group. Immunocytochemistry analysis for chondroitin-6-sulfate showed no difference between the C and Cal groups. In conclusion, the topical application of C. officinalis after tendon transection increases the concentrations of collagen and non-collagenous proteins, as well as the collagen organization in the initial phase of healing.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Modelo para análise do ataque no futebol = : A model to analyze soccer offensive phase

Universidade Estadual de Campinas . Faculdade de Educação Física

Análise do desempenho em testes de triathlon com diferentes intensidades durante a etapa natação = : Analysis of triathlon trials performance using different intensities during swimming phase

Universidade Estadual de Campinas . Faculdade de Educação Física