Association Between Parity, Pre-pregnancy Body Mass Index And Gestational Weight Gain.

To analyze the relationship between parity, pre-pregnancy body mass index (BMI), and gestational weight gain (GWG). This observational controlled study was conducted from November 2013 to April 2014, with postpartum women who started antenatal care up to 14 weeks and had full-term births. Data were collected from medical records and antenatal cards. Descriptive and bivariate analyses were performed. The significance level was 5%. Data were collected from 130 primiparous and 160 multiparous women. At the beginning of prenatal care, 54.62% of the primiparous were eutrophic, while the majority of multiparous were overweight or obese (62.51%). Multiparas are two times more likely to be obese at the beginning of their pregnancies, when compared to primiparas. The average pre-pregnancy weight and final pregnancy weight was significantly higher in multiparous, however, the mean GWG was higher among primiparous. We found an inverse correlation between parity and the total GWG, but initial BMI was significantly higher in multiparas. Nevertheless, monitoring of the GWG through actions that promote a healthier lifestyle is needed, regardless of parity and nutritional status, in order to prevent excessive GWG and postpartum weight retention and consequently inadequate pre-pregnancy nutritional status in future pregnancies.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Association Between Unilateral Tonsillar Enlargement And Lymphoma In Children: A Systematic Review And Meta-analysis.

Lymphoma is the most common head and neck malignancy in children, and palatine tonsils asymmetry is the most frequent clinical manifestation of tonsillar lymphoma. However, several studies with children with tonsillar asymmetry found no case of lymphoma, showing that the relationship of tonsillar asymmetry with lymphoma is unclear. In this review, we aimed to identify the association between tonsillar asymmetry and tonsillar lymphoma in children by conducting systematic reviews of the literature on children with palatine tonsil lymphoma and tonsillar asymmetry. Articles comprising the paediatric age group (up to 18 years) with information concerning clinical manifestations of tonsillar lymphoma or the diagnosis of the tonsillar asymmetry were included. The main cause of asymmetry of palatine tonsils was lymphoid hyperplasia, followed by lymphoma and nonspecific benign changes. The asymmetry of tonsils was present in 73.2% of cases of lymphoma. There was an association between asymmetric palatine tonsils and lymphoma, with a likelihood ratio of 43.5 for children with asymmetry of palatine tonsils and 8938.4 for children with asymmetry of tonsils and other signs of suspicion for malignancy. We also provide recommendations on the management of suspicious cases of palatine tonsil lymphoma.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Association of insulin resistance and GLP-2 secretion in obesity: a pilot study

OBJECTIVE: The objective of this pilot study was to determine whether glugagon-like peptide 2 (GLP-2) secretion relates to insulin sensitivity (IS) in obese subjects. SUBJECTS AND METHODS: Twenty four obese subjects [body mass index (BMI) 40.0 ± 3.0 kg/m² (mean ± standard deviation)] were included, nine of which were male, age 43 ± 8 years. Twelve subjects had type 2 diabetes, all treated with oral anti-diabetic agents only. The subjects were submitted to standard meal tolerance test (MTT) for dosage of the curves: glucose, insulin, and GLP-2. Insulin sensitivity was measured by HOMA-IR, and OGIS was derived from the MTT. Spearman linear correlations and partial correlations were obtained. RESULTS: There was an inverse relationship between the GLP-2 secretion and IS: HOMA-IR correlated with GLP-2 AUC (R = 0.504; p = 0.012), and OGIS correlated with GLP-2 incremental AUC (R = -0.54; p = 0.054). The correlation persisted after controlling for BMI. CONCLUSION: We found an association of GLP-2 secretion and insulin resistance (IR). The understanding of the underlying mechanisms may provide future directions in the pharmacological manipulation of incretins, and in the treatment of obesity and related metabolic disorders.

New Guidelines Of Cerebral Cardiopulmonary Resuscitation By The American Heart Association (2005 - 2006) [novas Diretrizes De Reanimação Cardiorrespiratória Cerebral Da Sociedade Americana De Cardiologia (2005 - 2006)]

No abstract available