38 resultados para NOVA-LIKE VARIABLES


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This review reports the application of inorganic and organic polymeric materials for cation removal by using nitrogenated basic centers. The data demonstrate the importance of the desired groups when free or immobilized on natural or synthesized inorganic polymers through silanol groups. Thus, the most studied silica gel is followed by natural crysotile and talc polymers, and the synthesized mesopore silicas, talc-like, silicic acids, phosphates and phyllosilicates. The organic natural biopolymeric chitin and cellulose were chemically modified to improve the availability of the amine groups or the reactivity with desirable molecules to enlarge the content of basic centers. The cation removal takes place at the solid/liquid interface and some interactive effects have their thermodynamic data determined.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The chemical amount values vary in a discrete or continuous form, depending on the approach used to describe the system. In classical sciences, the chemical amount is a property of the macroscopic system and, like any other property of the system, it varies continuously. This is neither inconsistent with the concept of indivisible particles forming the system, nor a mere approximation, but it is a sound concept which enables the use of differential calculus, for instance, in chemical thermodynamics. It is shown that the fundamental laws of chemistry are absolutely compatible to the continuous concept of the chemical amount.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Descriptors in multivariate image analysis applied to quantitative structure-activity relationship (MIA-QSAR) are pixels of bidimensional images of chemical structures (drawings), which were used to model the trichomonicidal activities of a series of benzimidazole derivatives. The MIA-QSAR model showed good predictive ability, with r², q² and r val. ext.² of 0.853, 0.519 and 0.778, respectively, which are comparable to the best values obtained by CoMFA e CoMSIA for the same series. A MIA-based analysis was also performed by using images of alphabetic letters with the corresponding numeric ordering as dependent variables, but no correlation was found, supporting that MIA-QSAR is not arbitrary.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This article shows that the term functionalism, very often understood as a single or uniform approach in linguistics, has to be understood in its different perspectives. I start by presenting an opposing conception similar to the I-language vs E-language in Chomsky (1986). As in the latter conception , language can be understood as an abstract model of a mind internal mechanism responsible for language production and perception or, as in the former one, it can be the description of the external use of language. Also like with formalists , there are functionalists who look for cross-linguistic variation (and universals of language use) and functionalists who look for language internal variation. It is also shown that functionalists can differ in the extent to which social variables are considered in the explanation of linguistic form.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A new species of Mimosa (Leguminosae, Mimosoideae, Mimosae) from Mato Grosso do Sul state, Midwestern Brazil, M. ferricola R.R. Silva & A.M.G. Azevedo, is described and illustrated. Morphologically M. ferricola is related to M. gemmulata Barneby and to M. nothopteris Barneby, and belongs to Mimosa sect. Batocaulon DC. ser. Leiocarpae Benth.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física