The Influence Of The Buffering Capacity On The Production Of Organic Acids And Alcohols From Wastewater In Anaerobic Reactor.

Some bacteria common in anaerobic digestion process can ferment a broad variety of organic compounds to organic acids, alcohols, and hydrogen, which can be used as biofuels. Researches are necessary to control the microbial interactions in favor of the alcohol production, as intermediary products of the anaerobic digestion of organic compounds. This paper reports on the effect of buffering capacity on the production of organic acids and alcohols from wastewater by a natural mixed bacterial culture. The hypothesis tested was that the increase of the buffering capacity by supplementation of sodium bicarbonate in the influent results in benefits for alcohol production by anaerobic fermentation of wastewater. When the influent was not supplemented with sodium bicarbonate, the chemical oxygen demand (COD)-ethanol and COD-methanol detected in the effluent corresponded to 22.5 and 12.7 % of the COD-sucrose consumed. Otherwise, when the reactor was fed with influent containing 0.5 g/L of sodium bicarbonate, the COD-ethanol and COD-methanol were effluents that corresponded to 39.2 and 29.6 % of the COD-sucrose consumed. Therefore, the alcohol production by supplementation of the influent with sodium bicarbonate was 33.6 % higher than the fermentation of the influent without sodium bicarbonate.

Ação de colorantes na degradação e estabilização de polímeros

Dyes and pigments are additives used in polymers to improve mainly the aesthetic properties of the material. However, the incorporation of these additives can directly affect polymer stability. The colorants can drastically decrease the lifetime and the performance of the material or can act as a stabilizer, improving significantly the stability of the polymer against degradation. Interaction between colorants and polymers is the cause of the stability changes. Some mechanisms are proposed to explain the action of colorants on polymers. However it is difficult to foresee this action without experiments. This work reviews the main mechanisms involved in the degradation and stabilization of polymers containing colorants.

Teores de corantes artificiais em alimentos determinados por cromatografia líquida de alta eficiência

Synthetic dyes are much used in processed foods. HPLC was applied to different types of snacks, such as colored cereals, chocolate confetti, chewing gums and candies for the determination of those additives. In the case of artificially colored breakfast cereals, 71% of the samples exceeded the allowed limits. Regarding the portions recommended for consumption by the makers of two of the samples, the amounts exceeded those allowed by the Brazilian legislation. In the case of chocolate confetti and candies none of the samples showed higher amounts than those allowed. However 37% of the chewing gum samples presented larger contents than the authorized ones, and one sample contained five times more synthetic dyes than allowed.

Produção de isomaltulose, um substituto da sacarose, utilizando glicosiltransferase microbiana

Isomaltulose, a functional isomer of sucrose, is a non-cariogenic reducing disaccharide; has a low glycemic index; selectively promotes growth of beneficial bifidobacteria in the human intestinal microflora; and has greater stability than sucrose in some foods and beverages. Isomaltulose is a nutritional sugar that is digested more slowly than sucrose, and has health advantages for diabetics and nondiabetics. Immobilization techniques, especially entrapment of the cells, are widely used for conversion of sucrose into isomaltulose. Immobilization offers advantages such as minimum downstream processing, continuous operation and reusability of cells. Isomaltulose is currently considered to be a promising sugar substitute.

Desempenho físico-mecânico de minipainéis de terra crua tratada com aditivos químicos

The aim of this research was to study the effect of chemical additives (lime and Portland cement) associated with sodium silicate on soil in order to obtain compressed soil bricks. Mini panels were constructed with such bricks being their physical and mechanical characteristics determined in laboratory conditions and their behavior evaluated through the association of destructive and non-destructive methods. For this purpose a sandy soil and a finely divided one were added to Portland cement and lime in the dosage of 6% and 10% taken in dry weight basis in relation to the dry soil. The sodium silicate dosage of 4% was also taken in dry weight basis in relation to the dry soil-cement or to the dry soil-lime. The compressed soil bricks were cured in a humidity chamber for 7; 28; 56 and 91 days. The bricks were laid on the fourteenth day to form prismatic mini panels each one with four layers of bricks. After 28; 56 and 91 days the mini panels were submitted to both; ultrasonic and compressive tests to determine its elastic properties (dynamic modulus) and the compressive resistance. The best results in terms of compressive strength, water absorption capacity or dynamic elastic modulus, were reached by the sandy soil added to 10% of Portland cement or lime associated with sodium silicate.

ESTUDO DA PREPARAÇÃO DOS EXTRATOS DE PRÓPOLIS E SUAS APLICAÇÕES

Ethanolic extracts from propolis were performed by using lhe water and vaflous coneentrations of etanol as solvent. The extracts were investigated by measurement of absorption spectruin with Uv-spectrophotometer (UV-scanning), reversed phase-high performance thin-layer chromatography, Reversed phase-HPLC. Maximum absorption of ali extracts was 290 nm, resembling flavonoid compounds and 80% ethanolic extract showed highest absorption at 290 nm. The most isosakuranetin, quercefin, and kaempferol were extracted from mixtures of propolis and 60% etanol, whereas 70% etanol extracted te most pinocembrin and sakuranetin, but 80% etanol extracted more kaempferide, acacetin, and isorhamnetin from propolis. The 60 to 80% ethanolic extracts ofpropolis inhibited highly to microbial growth and 70 and 80% ethanolic extracts showed lhe greatest antioxidant activity and 80% ethanolic extract inhibited highly to hyaluronidase activity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.