Resonancias discursivas y cortesía en prácticas de lecto-escritura

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

46,XX Male - Testicular Disorder of Sexual Differentiation (DSD): hormonal, molecular and cytogenetic studies

The XX male syndrome - Testicular Disorder of Sexual Differentiation (DSD) is a rare condition characterized by a spectrum of clinical presentations, ranging from ambiguous to normal male genitalia. We report hormonal, molecular and cytogenetic evaluations of a boy presenting with this syndrome. Examination of the genitalia at age of 16 months, showed: penis of 3.5 cm, proximal hypospadia and scrotal testes. Pelvic ultrasound did not demonstrate Mullerian duct structures. Karyotype was 46,XX. Gonadotrophin stimulation test yielded insufficient testosterone production. Gonadal biopsy showed seminiferous tubules without evidence of Leydig cells. Molecular studies revealed that SRY and TSPY genes and also DYZ3 sequences were absent. In addition, the lack of deletions or duplications of SOX9, NR5A1, WNT4 and NROB1 regions was verified. The infant was heterozygous for all microsatellites at the 9p region, including DMRT1 gene, investigated. Only 10% of the patients are SRY-negative and usually they have ambiguous genitalia, as the aforementioned patient. The incomplete masculinization suggests gain of function mutation in one or more genes downstream to SRY gene.

O jogo de futebol : investigação de sua estrutura, de seus modelos e da inteligencia de jogo, do ponto de vista da complexidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptações cardio-respiratorias em atletas : estudo em diferentes fases do treinamento fisico

Universidade Estadual de Campinas. Faculdade de Educação Física

Psicoterapia dinamica breve : uma intervenção alternativa na preparação psicologica de tenistas infanto-juvenis

Universidade Estadual de Campinas. Faculdade de Educação Física

Protocolo de avaliação da força muscular em ombros de sedentarios e atletas utilizando dinamometro isocinetico

Universidade Estadual de Campinas . Faculdade de Educação Física

Estudo da distribuição da pressão plantar e do equilibrio corporal em corredores de longa distancia

Universidade Estadual de Campinas . Faculdade de Educação Física

Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física

Ciclimo de velocidade : uma proposta de controle da preparação fisica especial

Universidade Estadual de Campinas . Faculdade de Educação Física

Relações entre marcadores digito-palamres e aptidão fisica em atletas de judo de elite

Universidade Estadual de Campinas . Faculdade de Educação Física

Testes de controle no judo : proposta de avaliação da resistencia especial do judoca

Universidade Estadual de Campinas . Faculdade de Educação Física

Educação fisica na 1ª serie do ensino medio : uma pratica por compromisso

Universidade Estadual de Campinas . Faculdade de Educação Física

A pratica do basquetebol feminino no estado de São Paulo : conhecendo e analisando seu contexto

Universidade Estadual de Campinas . Faculdade de Educação Física

O processo de ensino dos jogos desportivos coletivos : um estudo acerca do basquetebol

Universidade Estadual de Campinas . Faculdade de Educação Física