[impact Of The Activation Of Intention To Perform Physical Activity In Type Ii Diabetics: A Randomized Clinical Trial].

Type II diabetes mellitus is a highly prevalent disease among the adult Brazilian population, and one that can be controlled by interventions such as physical activity, among others. The aim of this randomized controlled study was to evaluate the impact of a traditional motivational strategy, associated with the activation of intention theory, on adherence to physical activity in patients with type II, diabetes mellitus who are part of the Unified Health System (SUS). Participants were divided into a control group (CG) and an intervention group (IG). In both groups, the traditional motivational strategy was applied, but the activation of intention strategy was only applied to the IG Group. After a two-month follow-up, statistically significant differences were verified between the groups, related to the practice of walking (p = 0.0050), number of days per week (p = 0.0076), minutes per day (p = 0.0050) and minutes walking per week (p = 0.0015). At the end of the intervention, statistically significant differences in abdominal circumference (p = 0.0048) between the groups were observed. The conclusion drawn is that the activation of intention strategy had greater impact on adherence to physical activity and reduction in abdominal circumference in type II diabetics, than traditional motivational strategy.

Impact Of Drug Formulation And Free Platinum/cisplatin Ratio On Hypersensitivity Reactions To Cisplatin: Formulation Matters.

Use of cisplatin can induce type I hypersensitivity reactions that may also be linked to the quality of the drug utilized. We observed cases of hypersensitivity that appeared to be associated with the brand of cisplatin used. The aim of this study was to compare two different brands of cisplatin in relation to type I hypersensitivity reactions. Brand A was used in a tertiary care teaching hospital until 2012, and use of brand B started from January 2013, when the first hypersensitivity cases were observed. Patients were categorized based on symptom. Cisplatin of both brands was analysed by high-performance liquid chromatography (HPLC) and high-resolution electrospray ionization mass spectrometry (ESI-(+)-MS) and characterized according to US Pharmacopeia. There were no cases of hypersensitivity associated with the use of cisplatin brand A, whereas four of 127 outpatients that used cisplatin brand B were affected. The two brands were in accordance with the US Pharmacopeia parameters, and there was no significant difference in the total platinum levels between the two brands when analysed by HPLC. However, high-resolution ESI-(+)-MS analyses show that brand B contains approximately 2.7 times more hydrolysed cisplatin than brand A. The increase in the hydrolysed form of cisplatin found in brand B may be the cause of the hypersensitivity reaction observed in a subset of patients. We present the first study of the quality of drugs by high-resolution ESI-(+)-MS. Drug regulatory agencies and manufacturers should consider including measurement of hydrolysed cisplatin as a quality criterion for cisplatin formulations.

Prognostic Impact Of Perineural Invasion And Lymphovascular Invasion In Advanced Stage Oral Squamous Cell Carcinoma.

Perineural invasion (PNI) and lymphovascular invasion (LVI) have been associated with the risk of local recurrences and lymph node metastasis. The aim of this study was to evaluate the prognostic impact of PNI and LVI in patients with advanced stage squamous cell carcinoma of the tongue and floor of the mouth. One hundred and forty-two patients without previous treatment were selected. These patients underwent radical surgery with neck dissection and adjuvant treatment. Clinicopathological data were retrieved from the medical charts, including histopathology and surgery reports. Univariate analysis was performed to assess the impact of studied variables on survival. Overall survival was negatively influenced by six tumour-related factors: increasing T stage (P = 0.003), more than two clinically positive nodes (P = 0.002), extracapsular spread of lymph node metastasis (P < 0.001), tumour thickness (P = 0.04), PNI (P < 0.001), and LVI (P = 0.012). Disease-free survival was influenced by PNI (P = 0.04), extracapsular spread of lymph node metastasis (P = 0.008), and N stage (P = 0.006). Multivariate analysis showed PNI to be an independent predictor for overall survival (P = 0.01) and disease-free survival (P = 0.03). Thus the presence of PNI in oral carcinoma surgical specimens has a significant impact on survival outcomes in patients with advanced stage tumours submitted to radical surgery and adjuvant radiotherapy/radiochemotherapy.

Determinação em tempo real da magnitude de danos físicos por impacto em linhas de beneficiamento e em condições de laboratório e seus efeitos na qualidade de tomate

Tomatoes are one of the most important vegetable crops grown in Brazil and are among the crops that have one of the highest post-harvest losses indexes in the country. The present work aimed at evaluating impact damage observed in packing lines of fresh tomatoes as well as to determine, under laboratory conditions, quality alterations of tomato fruits submitted to impact damage in different surface types. Critical points evaluation was accomplished using an instrumented sphere. Critical transference points found showed variations in acceleration levels from 30 to 129 G (m s-2). Tests carried out under laboratory conditions showed that padded surfaces reduced up to 31% impact damage. Incidence of severe internal physical damage was evaluated by a subjective scale and increased by 79% on hard surfaces for the highest fall drop. On the other hand, it was observed an effective reduction in physical damage on fruits when padded surfaces were used. When a 10-cm drop was performed, the maximum reduction measured was 10% for hard surfaces and 5% for previously padded surfaces. For quality parameters, it was observed for high drops on hard surfaces, highest values for weight loss, total acidity, lower values for vitamin C and Soluble Solids.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Validação da Body Appreciation Scale (BAS), Life Satisfaction Index for the Third Age (LSITA) e do Aging Perception Questionnaire (APQ) para a língua portuguesa no Brasil : um estudo em idosos brasileiros

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e estrutura fatorial do Body Shape Questionnaire, Body Esteem Scale e Body Appreciation Scale para mulheres brasileiras na meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física

Tradução, adaptação cultural e validação da escala Moorong Self-Efficacy Scale (MSES) para o português no Brasil = : Translation, cultural adaptation and validation of Moorong Self-Efficacy Scale (MSES) into Brazilian Portuguese

Universidade Estadual de Campinas . Faculdade de Educação Física

Adaptação e validação da escla ASKAS - Aging Sexual Knowledge and Attitudes Scale em idosos brasileiros

Universidade Estadual de Campinas . Faculdade de Educação Física