Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Hidrocarbonetos aromáticos policíclicos em margarina, creme vegetal e maionese

Polycyclic aromatic hydrocarbons (PAHs) are a group of compounds that have been the subject of much concern due to their toxic potential. In this study, margarine?s, vegetable cream and mayonnaise available on the Brazilian market were analyzed for pyrene, chrysene, benzo(a)pyrene, benzo(b)fluoranthene and dibenzo(a,h)anthracene. The analytical methodology involved liquid-liquid extraction, clean-up on silica gel column and determination by high performance liquid chromatography using fluorescence detector. Variable levels of contamination were found within differents brands of the same product and within differents batches of the same brand. The total PAH content was in the range of 4.1 to 7.1mug/kg in vegetable cream, 1.7 to 3.9mug/kg in margarine and 1.0 to 21.7mug/kg in mayonnaise. In general the products which according to the label contain corn oil showed the highest levels of contamination. Based on these results and on the importance of fat, oils and derived products for the intake of PAHs, it is recommended that producers of margarine, vegetable creams and mayonnaise start to control the contamination of the vegetable oils used in the elaboration of these products, in order to reduce the exposure of consumers to excessive amounts of potentially carcinogenic compounds.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Efeitos da atividade fisica sobre o sistema locomotor e nos habitos de vida

Universidade Estadual de Campinas. Faculdade de Educação Física