17 resultados para Epilepsy detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Machado de Assis (1839-1908) is considered the most important Brazilian writer and a great universal literary figure. Little is know about his medical, personal and family history. He hid his «disease» as much as possible. Machado referred to «strange things» having happened to him in his childhood. He described seizures as «nervous phenomena», «absenses», «my illness». Laet observed a seizure and described it as: «... when Machado approached us and spoke to me in disconnected words. I looked at him in surprise and found his features altered. Knowing that from time to time he had nervous problems,... and only permitted Machado take the Laranjeiras Street car, when I saw that he was completely well». A photographically documented seizure is shown. Alencar wrote, «The preoccupation with health was frequent: either he was having the consequences of a fit or was foreboding one». It is clear that Machado presented localized symptomatic epilepsy with complex partial seizures secondarily generalized of unknown etiology. The seizures which began in infancy or childhood had remission in adolescence and then recurred in his thirties and became more frequent in his later years. His depression got markedly worse with age. In our opinion, the greatest consequence of Machado's epilepsy, was his psychological suffering due to the prejudice of the times. Despite this Machado showed all his genius, which is still actual and universal.