Going Beyond Seizure Control: Can Pharmacotherapy Help To Restore Cognitive Network Function?

83

Mastication Movements And Sleep Quality Of Patients With Myofascial Pain: Occlusal Device Therapy Improvements.

Patients with myofascial pain experience impaired mastication, which might also interfere with their sleep quality. The purpose of this study was to evaluate the jaw motion and sleep quality of patients with myofascial pain and the impact of a stabilization device therapy on both parameters. Fifty women diagnosed with myofascial pain by the Research Diagnostic Criteria were enrolled. Pain levels (visual analog scale), jaw movements (kinesiography), and sleep quality (Epworth Sleepiness Scale; Pittsburgh Sleep Quality Index) were evaluated before (control) and after stabilization device use. Range of motion (maximum opening, right and left excursions, and protrusion) and masticatory movements during Optosil mastication (opening, closing, and total cycle time; opening and closing angles; and maximum velocity) also were evaluated. Repeated-measures analysis of variance in a generalized linear mixed models procedure was used for statistical analysis (α=.05). At baseline, participants with myofascial pain showed a reduced range of jaw motion and poorer sleep quality. Treatment with a stabilization device reduced pain (P<.001) and increased both mouth opening (P<.001) and anteroposterior movement (P=.01). Also, after treatment, the maximum opening (P<.001) and closing (P=.04) velocities during mastication increased, and improvements in sleep scores for the Pittsburgh Sleep Quality Index (P<.001) and Epworth Sleepiness Scale (P=.04) were found. Myofascial pain impairs jaw motion and quality of sleep; the reduction of pain after the use of a stabilization device improves the range of motion and sleep parameters.

Control Of The Properties Of Porous Chitosan-alginate Membranes Through The Addition Of Different Proportions Of Pluronic F68.

This work addresses the development and characterization of porous chitosan-alginate based polyelectrolyte complexes, obtained by using two different proportions of the biocompatible surfactant Pluronic F68. These biomaterials are proposed for applications as biodegradable and biocompatible wound dressing and/or scaffolds. The results indicate that thickness, roughness, porosity and liquid uptake of the membranes increase with the amount of surfactant used, while their mechanical properties and stability in aqueous media decrease. Other important properties such as color and surface hydrophilicity (water contact angle) are not significantly altered or did not present a clear tendency of variation with the increase of the amount of surfactant added to the polyelectrolyte complexes, such as real density, average pore diameter, total pore volume and surface area. The prepared biomaterials were not cytotoxic to L929 cells. In conclusion, it is possible to tune the physicochemical properties of chitosan-alginate polyelectrolyte complexes, through the variation of the proportion of surfactant (Pluronic F68) added to the mixture, so as to enable the desired application of these biomaterials.

Onset Of Hypertension During Pregnancy Is Associated With Long-term Worse Blood Pressure Control And Adverse Cardiac Remodeling.

Up to 20% of women with hypertensive pregnancy disorders might persist with chronic hypertension. This study compared clinical and echocardiographic features between women whose hypertension began as hypertensive pregnancy disorders (PH group) and women whose diagnosis of hypertension did not occur during pregnancy (NPH group). Fifty PH and 100 NPH women were cross-sectionally evaluated by clinical, laboratory, and echocardiography analysis, and the groups were matched by duration of hypertension. PH exhibited lower age (46.6 ± 1.4 vs. 65.3 ± 1.1 years; P < .001), but higher systolic (159.8 ± 3.9 vs. 148.0 ± 2.5 mm Hg; P = .009) and diastolic (97.1 ± 2.4 vs. 80.9 ± 1.3 mm Hg; P < .001) blood pressure than NPH, although used more antihypertensive classes (3.4 ± 0.2 vs. 2.6 ± 0.1; P < .001). Furthermore, PH showed higher left ventricular wall thickness and increased prevalence of concentric hypertrophy than NPH after adjusting for age and blood pressure. In conclusion, this study showed that PH may exhibit worse blood pressure control and adverse left ventricular remodeling compared with NPH.

Behavior Of Listeria Monocytogenes In A Multi-species Biofilm With Enterococcus Faecalis And Enterococcus Faecium And Control Through Sanitation Procedures.

The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organisms<0.4 log CFU/cm(2)). Peracetic acid was the most effective disinfectant, eliminating the multi-species biofilms under all tested conditions (counts of the all microorganisms <0.4 log CFU/cm(2)). In contrast, biguanide was the least effective disinfectant, failing to eliminate biofilms under all the test conditions.

Two-dimensional Ultrasound And Ultrasound Elastography Imaging Of Trigger Points In Women With Myofascial Pain Syndrome Treated By Acupuncture And Electroacupuncture: A Double-blinded Randomized Controlled Pilot Study.

Chronic pain has been often associated with myofascial pain syndrome (MPS), which is determined by myofascial trigger points (MTrP). New features have been tested for MTrP diagnosis. The aim of this study was to evaluate two-dimensional ultrasonography (2D US) and ultrasound elastography (UE) images and elastograms of upper trapezius MTrP during electroacupuncture (EA) and acupuncture (AC) treatment. 24 women participated, aged between 20 and 40 years (M ± SD = 27.33 ± 5.05) with a body mass index ranging from 18.03 to 27.59 kg/m2 (22.59 ± 3.11), a regular menstrual cycle, at least one active MTrP at both right (RTPz) and left trapezius (LTPz) and local or referred pain for up to six months. Subjects were randomized into EA and AC treatment groups and the control sham AC (SHAM) group. Intensity of pain was assessed by visual analogue scale; MTrP mean area and strain ratio (SR) by 2D US and UE. A significant decrease of intensity in general, RTPz, and LTPz pain was observed in the EA group (p = 0.027; p < 0.001; p = 0.005, respectively) and in general pain in the AC group (p < 0.001). Decreased MTrP area in RTPz and LTPz were observed in AC (p < 0.001) and EA groups (RTPz, p = 0.003; LTPz, p = 0.005). Post-treatment SR in RTPz and LTPz was lower than pre-treatment in both treatment groups. 2D US and UE effectively characterized MTrP and surrounding tissue, pointing to the possibility of objective confirmation of subjective EA and AC treatment effects.

In Vivo Evaluation Of The Genetic Toxicity Of Rubus Niveus Thunb. (rosaceae) Extract And Initial Screening Of Its Potential Chemoprevention Against Doxorubicin-induced Dna Damage.

Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.

Biofilms Of Enterococcus Faecalis And Enterococcus Faecium Isolated From The Processing Of Ricotta And The Control Of These Pathogens Through Cleaning And Sanitization Procedures.

The biofilm formation of Enterococcus faecalis and Enterococcus faecium isolated from the processing of ricotta on stainless steel coupons was evaluated, and the effect of cleaning and sanitization procedures in the control of these biofilms was determined. The formation of biofilms was observed while varying the incubation temperature (7, 25 and 39°C) and time (0, 1, 2, 4, 6 and 8days). At 7°C, the counts of E. faecalis and E. faecium were below 2log10CFU/cm(2). For the temperatures of 25 and 39°C, after 1day, the counts of E. faecalis and E. faecium were 5.75 and 6.07log10CFU/cm(2), respectively, which is characteristic of biofilm formation. The tested sanitation procedures a) acid-anionic tensioactive cleaning, b) anionic tensioactive cleaning+sanitizer and c) acid-anionic tensioactive cleaning+sanitizer were effective in removing the biofilms, reducing the counts to levels below 0.4log10CFU/cm(2). The sanitizer biguanide was the least effective, and peracetic acid was the most effective. These studies revealed the ability of enterococci to form biofilms and the importance of the cleaning step and the type of sanitizer used in sanitation processes for the effective removal of biofilms.

Patterns Of Seizure Control In Patients With Mesial Temporal Lobe Epilepsy With And Without Hippocampus Sclerosis.

Objective Patients with mesial temporal lobe epilepsy (MTLE) may present unstable pattern of seizures. We aimed to evaluate the occurrence of relapse-remitting seizures in MTLE with (MTLE-HS) and without (MTLE-NL) hippocampal sclerosis. Method We evaluated 172 patients with MTLE-HS (122) or MTLE-NL (50). Relapse-remitting pattern was defined as periods longer than two years of seizure-freedom intercalated with seizure recurrence. Infrequent seizures was considered as up to three seizures per year and frequent seizures as any period of seizures higher than that. Results Thirty-seven (30%) MTLE-HS and 18 (36%) MTLE-NL patients had relapse-remitting pattern (X2, p = 0.470). This was more common in those with infrequent seizures (X2, p < 0.001). Twelve MTLE-HS and one MTLE-NL patients had prolonged seizure remission between the first and second decade of life (X2, p = 0.06). Conclusion Similar proportion of MTLE-HS or MTLE-NL patients present relapse-remitting seizures and this occurs more often in those with infrequent seizures.

Ankhd1 Represses P21 (waf1/cip1) Promoter And Promotes Multiple Myeloma Cell Growth.

ANKHD1 (Ankyrin repeat and KH domain-containing protein 1) is highly expressed and plays an important role in the proliferation and cell cycle progression of multiple myeloma (MM) cells. ANKHD1 downregulation modulates cell cycle gene expression and upregulates p21 irrespective of the TP53 mutational status of MM cell lines. The present study was aimed to investigate the role of ANKHD1 in MM in vitro clonogenicity and in vivo tumourigenicity, as well as the role of ANKHD1 in p21 transcriptional regulation. ANKHD1 silencing in MM cells resulted in significantly low no. of colonies formed and in slow migration as compared to control cells (p < 0.05). Furthermore, in xenograft MM mice models, tumour growth was visibly suppressed in mice injected with ANKHD1 silenced cells compared to the control group. There was a significant decrease in tumour volume (p = 0.006) as well as in weight (p = 0.02) in the group injected with silenced cells compared to those of the control group. Co-immunoprecipitation and chromatin immunoprecipitation (ChIP) assays confirmed the interaction between p21 and ANKHD1. Moreover, overexpression of ANKHD1 downregulated the activity of a p21 promoter in luciferase assays. Decrease in luciferase activity suggests a direct role of ANKHD1 in p21 transcriptional regulation. In addition confocal analysis after U266 cells were treated with Leptomycin B (LMB) for 24 h showed accumulation of ANKHD1 inside the nucleus as compared to untreated cells where ANKHD1 was found to be predominantly in cytoplasm. This suggests ANKHD1 might be shuttling between cytoplasm and nucleus. In conclusion, ANKHD1 promotes MM growth by repressing p21 a potent cell cycle regulator.

Avaliação de tipos de ventilação em maternidade de suínos

Livestock facilities, where animals carry their productive cycle, must have as main characteristic, the control of influence over climatic factors on animals. The environment variations can be controlled through the use of different ventilation systems. The objective of this research was to evaluate the influence of different environment conditioning systems on swine nursery. Three treatments have been tested: natural ventilation, cooled ventilation and forced ventilation. The climatic parameters evaluated were: air temperature, relative humidity and black globe temperature. The physiological parameters analyzed were: respiratory frequency and back fat thickness. Number of born alive piglets, average weight at weaning and number of weaned piglets were also evaluated parameters. The use of cooled ventilation systems were able to decreased animal's air temperature and respiratory frequency, and the black globe temperature and humidity index (WBGT) and the radiating thermal load (RTL).

Factors associated with the prevalence of hypertension and control practices among elderly residents of São Paulo city, Brazil

The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Sistema de análise de movimento para avaliação da postura vertical durante a corrida no teste de esforço máximo incremental

Universidade Estadual de Campinas . Faculdade de Educação Física

Analise cinematica da movimentação dos membros superiores e inferiores, tronco e cabeça durante a marcha de hemipareticos

Universidade Estadual de Campinas . Faculdade de Educação Física