Encephalization And Diversification Of The Cranial Base In Platyrrhine Primates.

The cranial base, composed of the midline and lateral basicranium, is a structurally important region of the skull associated with several key traits, which has been extensively studied in anthropology and primatology. In particular, most studies have focused on the association between midline cranial base flexion and relative brain size, or encephalization. However, variation in lateral basicranial morphology has been studied less thoroughly. Platyrrhines are a group of primates that experienced a major evolutionary radiation accompanied by extensive morphological diversification in Central and South America over a large temporal scale. Previous studies have also suggested that they underwent several evolutionarily independent processes of encephalization. Given these characteristics, platyrrhines present an excellent opportunity to study, on a large phylogenetic scale, the morphological correlates of primate diversification in brain size. In this study we explore the pattern of variation in basicranial morphology and its relationship with phylogenetic branching and with encephalization in platyrrhines. We quantify variation in the 3D shape of the midline and lateral basicranium and endocranial volumes in a large sample of platyrrhine species, employing high-resolution CT-scans and geometric morphometric techniques. We investigate the relationship between basicranial shape and encephalization using phylogenetic regression methods and calculate a measure of phylogenetic signal in the datasets. The results showed that phylogenetic structure is the most important dimension for understanding platyrrhine cranial base diversification; only Aotus species do not show concordance with our molecular phylogeny. Encephalization was only correlated with midline basicranial flexion, and species that exhibit convergence in their relative brain size do not display convergence in lateral basicranial shape. The evolution of basicranial variation in primates is probably more complex than previously believed, and understanding it will require further studies exploring the complex interactions between encephalization, brain shape, cranial base morphology, and ecological dimensions acting along the species divergence process.

Phenotypic Polymorphism Of Chrysomya Albiceps (wiedemann) (diptera: Calliphoridae) May Lead To Species Misidentification.

Species identification is an essential step in the progress and completion of work in several areas of biological knowledge, but it is not a simple process. Due to the close phylogenetic relationship of certain species, morphological characters are not always sufficiently distinguishable. As a result, it is necessary to combine several methods of analysis that contribute to a distinct categorization of taxa. This study aimed to raise diagnostic characters, both morphological and molecular, for the correct identification of species of the genus Chrysomya (Diptera: Calliphoridae) recorded in the New World, which has continuously generated discussion about its taxonomic position over the last century. A clear example of this situation was the first record of Chrysomya rufifacies in Brazilian territory in 2012. However, the morphological polymorphism and genetic variability of Chrysomya albiceps studied here show that both species (C. rufifacies and C. albiceps) share very similar character states, leading to misidentification and subsequent registration error of species present in our territory. This conclusion is demonstrated by the authors, based on a review of the material deposited in major scientific collections in Brazil and subsequent molecular and phylogenetic analysis of these samples. Additionally, we have proposed a new taxonomic key to separate the species of Chrysomya found on the American continent, taking into account a larger number of characters beyond those available in current literature.

Síntese de complexo ferro(II)-nitrogênio: abordagem dos conceitos de reatividade e retro-doação para alunos de graduação em química

There has been a considerable interest in coordination complexes of molecular nitrogen (N2), partly due to a possible relationship between such complexes and the nitrogen activation process in nature. The present paper describes the synthesis and infrared spectroscopic characterization of an iron-nitrogen derivative with ethylenediamine-N,N,N',N'-tetraacetate (edta) as an experiment for an undergraduate course. The topics covered here include synthesis, reactivity and spectroscopy.

Avaliação da biodegradabilidade anaeróbia de resíduos da bovinocultura e da suinocultura

The biodegradability of animal wastes production was evaluated through a simplified methodology that allowed the verification of the applicability of anaerobic processes. The experiments were performed in bath reactors, with granular sludge of three origins: UASB reactor treating dairy effluent, UASB reactor treating swine effluent and UASB reactor treating effluent of slaughterhouse of poultry. The experiments (1) - dairy effluent and poultry slaughterhouse non-adapted sludge; (2) -swine effluent and poultry slaughterhouse non-adapted sludge; (3) - dairy effluent and poultry slaughterhouse adapted sludge; (4) - swine effluent and poultry slaughterhouse adapted sludge; (5) - dairy effluent and dairy sludge, and (6) - swine effluent and swine sludge were performed in Incubator Shaker, at a temperature of 35 °C, under agitation at a 150 rpm, for 5 minutes, every 1 hour. A substrat:biomass relationship of 0.5 was used. Kinetic models of Monod, Zero Order, First and Second Order were tested and it was verified that the First Order model provided the best adjustment. The apparent First Order kinetic parameter (k1) was estimated for the experiments 1; 2; 3; 4; 5, and 6, as 2.51 x 10-2; 2.49 x 10-2; 1.90 x 10-2; 3.09 x 10-2; 2.54 x 10-2; 4.09 x 10-2 h-1, respectively.

Identificação eletrônica para avaliação do comportamento dos suínos na fase de gestação

The efficiency of swine production performance depends on the herd administration, such as good nutrition, sanitary control, facilities and appropriate environmental conditions. The concept of this production model is directly related with the reduction of selective losses and the process control. Each production segment is controlled to reach the optimization in the system totality, it is necessary to apply animals handling concepts, environmental control implementation, diseases control, nutrition control, information concerning in guaranteeing the animal welfare and individual identification. The present work presents as objective the development of the mathematical model to evaluate interactions among the internal atmosphere of the installation and the thermal animals preference, in the expectation of detecting a relationship among the frequency access to the drinking fountain and the atmosphere conditions - temperature, black globe temperature and relative humidity, using as tool the electronic identification. The results obtained by the mathematical model, allowed to conclude accurately the evaluation of the swine thermal preference correlating with the climatic variables in the pregnancy stage.

The relationship between physical aspects of quality of life and extreme levels of regular physical activity in adults

This study aimed to check for any significant differences in perceived quality of life, specifically aspects of a physical nature, among volunteers who are more physically active and those less physically active in a university community. The sample consisted of 1,966 volunteers in a university community in Brazil. To assess physical activity levels, volunteers responded to the International Physical Activity Questionnaire (IPAQ), and to analyse the perception of quality of life they responded to WHOQOL-bref, which is classified into three groups according to level of physical activity, taking into account the metabolic equivalent index (MET) over a full week. For comparison, consideration was given to the first and third tertiles, respectively, namely groups of more and less active students. The results indicated that individuals who engaged in more physical activity had a more positive perception of quality of life compared to those who were less active in physical aspects related to the ability to work, energy for day-to-day activities and locomotion.

Autoscopia: um procedimento de pesquisa e de formação

This article considers a procedure for data collection called autoscopy. Autoscopy entails the video recording of a practice with the purpose of allowing analysis and self-evaluation by one of the protagonists of that practice. The objective of the video recording is that of apprehending the actions of the agent (or agents), the scenario, and the plot that make up a situation. The recorded material is subjected to sessions of analysis after the action that aim at the understanding of the reflective process of the agent (or agents) through their verbalizations during the analysis of video recorded scenes. The present text introduces a theoretical basis for the procedure of autoscopy, deals with advantages and limitations of its use, as well as with aspects that deserve attention and, finally, describes the authors' experiences in two studies in which the procedure was employed. Starting from these two experiences, differences and similarities are pointed out between the studies, especially regarding the participants, object, and the time distribution of the video recordings. The authors draw considerations about the formative-reflective potential of the procedure, both for research situations and for the learning and training of various professionals, considering it to be an excellent educational instrument. It is, however, vital to keep in mind the need to recognize and return to the teacher, as an autoscopic participant, his condition as subject of his own profession, thereby promoting, besides the self-evaluation, also the autonomy of his thinking and doing.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O esporte paraolímpico no Brasil : abordagem da sociologia do esporte de Pierre Bourdieu

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodos de avaliação em Educação Fisica no ensino fundamental

Universidade Estadual de Campinas . Faculdade de Educação Física

Uma leitura da questão da deficiencia e da inclusão no ensino municipal de Hortolandia : olhares e ações da docencia de Educação Fisica e de seus pares

Universidade Estadual de Campinas . Faculdade de Educação Física

Correlação entre o ponto de compensação respiratoria e desempenho em corredores de rua

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividade motora adaptada : o conhecimento produzido nos programas Stricto Sensu em Educação Física no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

As aulas de educação fisica escolar : uma analise do processo inclusivo

Universidade Estadual de Campinas. Faculdade de Educação Física

A comunicação corporal na pre-escola : caminhos e descaminhos

Universidade Estadual de Campinas . Faculdade de Educação Física