Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Didanosine-loaded Chitosan Microspheres Optimized By Surface-response Methodology: A Modified Maximum Likelihood Classification" Approach Formulation For Reverse Transcriptase Inhibitors."

Didanosine-loaded chitosan microspheres were developed applying a surface-response methodology and using a modified Maximum Likelihood Classification. The operational conditions were optimized with the aim of maintaining the active form of didanosine (ddI), which is sensitive to acid pH, and to develop a modified and mucoadhesive formulation. The loading of the drug within the chitosan microspheres was carried out by ionotropic gelation technique with sodium tripolyphosphate (TPP) as cross-linking agent and magnesium hydroxide (Mg(OH)2) to assure the stability of ddI. The optimization conditions were set using a surface-response methodology and applying the Maximum Likelihood Classification, where the initial chitosan concentration, TPP and ddI concentration were set as the independent variables. The maximum ddI-loaded in microspheres (i.e. 1433mg of ddI/g chitosan), was obtained with 2% (w/v) chitosan and 10% TPP. The microspheres depicted an average diameter of 11.42μm and ddI was gradually released during 2h in simulated enteric fluid.

Key Participants Of The Tumor Microenvironment Of The Prostate: An Approach Of The Structural Dynamic Of Cellular Elements And Extracellular Matrix Components During Epithelial-stromal Transition.

Cancer is a multistep process that begins with the transformation of normal epithelial cells and continues with tumor growth, stromal invasion and metastasis. The remodeling of the peritumoral environment is decisive for the onset of tumor invasiveness. This event is dependent on epithelial-stromal interactions, degradation of extracellular matrix components and reorganization of fibrillar components. Our research group has studied in a new proposed rodent model the participation of cellular and molecular components in the prostate microenvironment that contributes to cancer progression. Our group adopted the gerbil Meriones unguiculatus as an alternative experimental model for prostate cancer study. This model has presented significant responses to hormonal treatments and to development of spontaneous and induced neoplasias. The data obtained indicate reorganization of type I collagen fibers and reticular fibers, synthesis of new components such as tenascin and proteoglycans, degradation of basement membrane components and elastic fibers and increased expression of metalloproteinases. Fibroblasts that border the region, apparently participate in the stromal reaction. The roles of each of these events, as well as some signaling molecules, participants of neoplastic progression and factors that promote genetic reprogramming during epithelial-stromal transition are also discussed.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Surgical treatment of patients with cervical spinal cord injury by anterior approach using bone graft

179

Um novo método para quantificar mercúrio orgânico (Hg orgânico) empregando a espectrometria de fluorescência atômica do vapor frio

In this work a simple and sensitive procedure to extract organic mercury from water and sediment samples, using methylene chloride in acidic media followed by CVAFS quantification has been developed. The method was evaluated for possible interferents, using different inorganic mercury species and humic acid, no effects being observed. The detection limit for organic mercury was 160 pg and 396 pg for water and sediment samples respectively. The accuracy of the method was evaluated using a certified reference material of methylmercury (BCR-580, estuarine sediment). Recovery tests using methylmercury as surrogate spiked with 1.0 up to 30.0 ng L-1 ranged from 90 up to 109% for water samples, whereas for sediments, recoveries ranged from 57 up to 97%.

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.