21 resultados para Data detection


Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

cDNA arrays are a powerful tool for discovering gene expression patterns. Nylon arrays have the advantage that they can be re-used several times. A key issue in high throughput gene expression analysis is sensitivity. In the case of nylon arrays, signal detection can be affected by the plastic bags used to keep membranes humid. In this study, we evaluated the effect of five types of plastics on the radioactive transmittance, number of genes with a signal above the background, and data variability. A polyethylene plastic bag 69 μm thick had a strong shielding effect that blocked 68.7% of the radioactive signal. The shielding effect on transmittance decreased the number of detected genes and increased the data variability. Other plastics which were thinner gave better results. Although plastics made from polyvinylidene chloride, polyvinyl chloride (both 13 μm thick) and polyethylene (29 and 7 μm thick) showed different levels of transmittance, they all gave similarly good performances. Polyvinylidene chloride and polyethylene 29 mm thick were the plastics of choice because of their easy handling. For other types of plastics, it is advisable to run a simple check on their performance in order to obtain the maximum information from nylon cDNA arrays.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJECTIVE: To characterize the behavior of premature newborns in the first year of chronological age. METHODS: This is a cross-sectional descriptive study, bound to a longitudinal study titled: Comparison of visual behavior on the first quarter of year of life of premature nursling born at two maternities of Recife/PE. The sample was composed by 52 premature newborns selected from June, 2007 to June, 2008 from the Maternity of the Federal University of Pernambuco (UFPE). Biological, socioeconomic and demographic data was collected through medical records and interviews with progeny. Newborns were evaluated by the Assessment Guide of Visual Ability in Infants. RESULTS: Most of the newborns were male at a gestational period between 33 weeks and 36 weeks and 6 days, showed a good visual behavior development for the age researched, and most of the families showed good socioeconomical and demographic profile. Besides, it was possible to detect ocular signs in 19% of sample, that were referred to an Ophthalmology Service. CONCLUSION: This study results point out the method like an important key in the early detection and visual screening for premature nursling since the first month of life and it led us to believe that clinical view for occupational therapy intervention must be focused not only on biological risks but also at the influence environment in newborn performance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física