[construction Of Measurement Instruments In The Area Of Health].

Measurement instruments are an integral part of clinical practice, health evaluation and research. These instruments are only useful and able to present scientifically robust results when they are developed properly and have appropriate psychometric properties. Despite the significant increase of rating scales, the literature suggests that many of them have not been adequately developed and validated. The scope of this study was to conduct a narrative review on the process of developing new measurement instruments and to present some tools which can be used in some stages of the development process. The steps described were: I-The establishment of a conceptual framework, and the definition of the objectives of the instrument and the population involved; II-Development of the items and of the response scales; III-Selection and organization of the items and structuring of the instrument; IV-Content validity, V-Pre-test. This study also included a brief discussion on the evaluation of the psychometric properties due to their importance for the instruments to be accepted and acknowledged in both scientific and clinical environments.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

The use of fluorescence in situ hybridization in the diagnosis of hidden mosaicism: apropos of three cases of sex chromosome anomalies

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Spontaneous puberty in girls with early diagnosis of Turner syndrome

OBJECTIVE: To verify if the frequency of spontaneous pubertal development among girls with Turner syndrome (TS) diagnosed in infancy and childhood is greater than that of patients diagnosed later. SUBJECTS AND METHODS: Thirty three girls aged < 10 years at the time of diagnosis were evaluated regarding pubertal development. The frequency of spontaneous puberty was compared with that of girls aged > 13 years diagnosed at the same service. RESULTS: Sixteen of 32 informative patients had signs of spontaneous puberty, a frequency greater than that of patients diagnosed later. In six patients, there was no progression of puberty; menarche occurred in six, and one became pregnant, but the fetus was a stillborn. Spontaneous puberty was absent in all cases with 45,X karyotype. CONCLUSIONS: The greater prevalence of spontaneous puberty in girls whose diagnosis was not based on pubertal delay suggests that, among those diagnosed later, there is a bias towards patients with hypogonadism. Arq Bras Endocrinol Metab. 2012;56(9):653-7

Monitoramento de parâmetros imunológicos em atletas adolescentes de basquetebol durante e após a temporada esportiva= : Monitoring of immunological parameters in adolescent basketball athletes during and after a sports season

Universidade Estadual de Campinas . Faculdade de Educação Física