Gluttonous predators: how to estimate prey size when there are too many prey

Prey size is an important factor in food consumption. In studies of feeding ecology, prey items are usually measured individually using calipers or ocular micrometers. Among amphibians and reptiles, there are species that feed on large numbers of small prey items (e.g. ants, termites). This high intake makes it difficult to estimate prey size consumed by these animals. We addressed this problem by developing and evaluating a procedure for subsampling the stomach contents of such predators in order to estimate prey size. Specifically, we developed a protocol based on a bootstrap procedure to obtain a subsample with a precision error of at the most 5%, with a confidence level of at least 95%. This guideline should reduce the sampling effort and facilitate future studies on the feeding habits of amphibians and reptiles, and also provide a means of obtaining precise estimates of prey size.

Apedunculata discoidea gen. n., sp. n. (Monogenea: Dactylogyridae) parasitic on Prochilodus lineatus (Valenciennes, 1837) (Characiformes: Prochilodontidae) from southeastern Brazil

A new species of dactylogyrid monogenean, Apedunculata discoidea gen. n., sp. n. is described and illustrated from the gills of the freshwater fish Prochilodus lineatus (Valenciennes, 1837) in pisciculture ponds from Pirassununga, São Paulo, Brazil. Diagnostic characters of the new genus and species are: 1) vagina dextrolateral slightly sclerotised, opening anteriorly at level of copulatory complex; 2) copulatory organ coiled with two counterclockwise rings; 3) Accessory piece distal and not articulated; 4) body disk-shaped, lacking a peduncle.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O panorama da ginastica artistica masculina brasileira : um estudo historico-critico do periodo 2005-2008

Universidade Estadual de Campinas . Faculdade de Educação Física

Desenvolvimento de equações generalizadas para estimativa da coordenação motora em crianças e adolescentes portadores de deficiencia mental

Universidade Estadual de Campinas . Faculdade de Educação Física

O rugbi em cadeira de rodas : aspectos tecnicos e taticos e diretrizes para seu desenvolvimento

Universidade Estadual de Campinas . Faculdade de Educação Física

Atividade motora adaptada : o conhecimento produzido nos programas Stricto Sensu em Educação Física no Brasil

Universidade Estadual de Campinas . Faculdade de Educação Física

Desenvolvimento humano, lazer e educação fisica escolar : o papel do componente ludico da cultura

Universidade Estadual de Campinas. Faculdade de Educação Física

Brincando no ambiente natural : uma contribuição para o desenvolvimento sensorio-motor da criança portadora de paralisia cerebral

Universidade Estadual de Campinas . Faculdade de Educação Física

Desenvolvimento de um laboratorio basico de biomecanica

Universidade Estadual de Campinas. Faculdade de Educação Física

O papel da propriocepção no desenvolvimento da força muscular e da flexibilidade

Universidade Estadual de Campinas . Faculdade de Educação Física

Jogos cooperativos : o jogo e o esporte como um exercicio de convivencia

Universidade Estadual de Campinas . Faculdade de Educação Física

A ginastica geral na sociedade contemporanea : pespectivas para a Educação Fisica escolar

Universidade Estadual de Campinas. Faculdade de Educação Física

Lazer como pratica educativa : as possibilidades para o desenvolvimento humano

Universidade Estadual de Campinas. Faculdade de Educação Física

Educação fisica adaptada : proposta de ação metodologica para formação universitaria

Universidade Estadual de Campinas. Faculdade de Educação Física