Sci1 Is A Component Of The Auxin-dependent Control Of Cell Proliferation In Arabidopsis Upper Pistil.

To characterize the recently described SCI1 (stigma/style cell cycle inhibitor 1) gene relationship with the auxin pathway, we have taken the advantage of the Arabidopsis model system and its available tools. At first, we have analyzed the At1g79200 T-DNA insertion mutants and constructed various transgenic plants. The loss- and gain-of-function plants displayed cell number alterations in upper pistils that were controlled by the amino-terminal domain of the protein. These data also confirmed that this locus holds the functional homolog (AtSCI1) of the Nicotiana tabacum SCI1 gene. Then, we have provided some evidences the auxin synthesis/signaling pathways are required for downstream proper AtSCI1 control of cell number: (a) its expression is downregulated in yuc2yuc6 and npy1 auxin-deficient mutants, (b) triple (yuc2yuc6sci1) and double (npy1sci1) mutants mimicked the auxin-deficient phenotypes, with no synergistic interactions, and (c) the increased upper pistil phenotype in these last mutants, which is a consequence of an increased cell number, was able to be complemented by AtSCI1 overexpression. Taken together, our data strongly suggests SCI1 as a component of the auxin signaling transduction pathway to control cell proliferation/differentiation in stigma/style, representing a molecular effector of this hormone on pistil development.

On The Consistency Of Monte Carlo Track Structure Dna Damage Simulations.

Monte Carlo track structures (MCTS) simulations have been recognized as useful tools for radiobiological modeling. However, the authors noticed several issues regarding the consistency of reported data. Therefore, in this work, they analyze the impact of various user defined parameters on simulated direct DNA damage yields. In addition, they draw attention to discrepancies in published literature in DNA strand break (SB) yields and selected methodologies. The MCTS code Geant4-DNA was used to compare radial dose profiles in a nanometer-scale region of interest (ROI) for photon sources of varying sizes and energies. Then, electron tracks of 0.28 keV-220 keV were superimposed on a geometric DNA model composed of 2.7 × 10(6) nucleosomes, and SBs were simulated according to four definitions based on energy deposits or energy transfers in DNA strand targets compared to a threshold energy ETH. The SB frequencies and complexities in nucleosomes as a function of incident electron energies were obtained. SBs were classified into higher order clusters such as single and double strand breaks (SSBs and DSBs) based on inter-SB distances and on the number of affected strands. Comparisons of different nonuniform dose distributions lacking charged particle equilibrium may lead to erroneous conclusions regarding the effect of energy on relative biological effectiveness. The energy transfer-based SB definitions give similar SB yields as the one based on energy deposit when ETH ≈ 10.79 eV, but deviate significantly for higher ETH values. Between 30 and 40 nucleosomes/Gy show at least one SB in the ROI. The number of nucleosomes that present a complex damage pattern of more than 2 SBs and the degree of complexity of the damage in these nucleosomes diminish as the incident electron energy increases. DNA damage classification into SSB and DSB is highly dependent on the definitions of these higher order structures and their implementations. The authors' show that, for the four studied models, different yields are expected by up to 54% for SSBs and by up to 32% for DSBs, as a function of the incident electrons energy and of the models being compared. MCTS simulations allow to compare direct DNA damage types and complexities induced by ionizing radiation. However, simulation results depend to a large degree on user-defined parameters, definitions, and algorithms such as: DNA model, dose distribution, SB definition, and the DNA damage clustering algorithm. These interdependencies should be well controlled during the simulations and explicitly reported when comparing results to experiments or calculations.

National Institutes Of Health Consensus Development Project On Criteria For Clinical Trials In Chronic Graft-versus-host Disease: I. The 2014 Diagnosis And Staging Working Group Report.

The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Predictors Of Silent Myocardial Ischemia In Resistant Hypertensive Patients.

Hypertension is the most prevalent and significant modifiable risk factor for coronary heart disease. A portion of patients with uncontrolled hypertension are considered to have resistant hypertension (RHTN). Myocardial ischemia incidence increases along with blood pressure (BP) levels. However, the prevalence of myocardial ischemia in patients with RHTN, as well as the factors associated with it, is unknown. We enrolled 129 patients with true RHTN regularly followed in our specialty hypertension clinic and evaluated then by resting and dipyridamole pharmacological stress myocardial perfusion scintigraphy. Patients were then divided into 2 groups: those with (I-RHTN; n = 36) and those without (NI-RHTN; n = 93) myocardial ischemia. Echocardiography, 24-hour ambulatory BP monitoring (ABPM), and flow mediated dilation (FMD) were also evaluated. Thirty six (28%) patients had myocardial ischemia. There was no difference between groups regarding age, sex, biochemical parameters, office, and 24-hour ABPM levels. Patients in the I-RHTN group were more likely diabetic (31% vs. 11%; P < 0.05) and obese (75% vs. 40%; P < 0.001). Adjusting for age and body mass index, multiple logistic regression showed that diabetes (odds ratio (OR) = 6.5; 95% confidence interval (CI) = 1.06-40.14; P = 0.04), FMD (OR = 0.18; 95% CI = 0.07-0.41; P < 0.001), heart rate (OR = 1.23; 95% CI = 1.11-1.36; P < 0.001), left ventricular mass index (OR = 1.02; 95% CI = 1.01-1.04; P = 0.04), and microalbuminuria (OR = 1.02; 95% CI = 1.01-1.04; P = 0.002) were independent predictors of ischemia. In conclusion, there is a high prevalence of myocardial ischemia in patients with RHTN. Increased microalbuminuria, heart rate, endothelial dysfunction, and left ventricular mass can be useful to guide the investigation for myocardial ischemia in these high risk patients.

In Vivo Evaluation Of The Genetic Toxicity Of Rubus Niveus Thunb. (rosaceae) Extract And Initial Screening Of Its Potential Chemoprevention Against Doxorubicin-induced Dna Damage.

Rubus niveus Thunb. plant belongs to Rosaceae family and have been used traditionally to treat wounds, burns, inflammation, dysentery, diarrhea and for curing excessive bleeding during menstrual cycle. The present study was undertaken to investigate the in vivo genotoxicity of Rubus niveus aerial parts extract and its possible chemoprotection on doxorubicin (DXR)-induced DNA damage. In parallel, the main phytochemicals constituents in the extract were determined. The animals were exposed to the extract for 24 and 48h, and the doses selected were 500, 1000 and 2000mg/kg b.w. administered by gavage alone or prior to DXR (30mg/kg b.w.) administered by intraperitoneal injection. The endpoints analyzed were DNA damage in bone marrow and peripheral blood cells assessed by the alkaline alkaline (pH>13) comet assay and bone marrow micronucleus test. The results of chemical analysis of the extract showed the presence of tormentic acid, stigmasterol, quercitinglucoronide (miquelianin) and niga-ichigoside F1 as main compounds. Both cytogenetic endpoints analyzed showed that there were no statistically significant differences (p>0.05) between the negative control and the treated groups with the two higher doses of Rubus niveus extract alone, demonstrating absence of genotoxic and mutagenic effects. Aneugenic/clastogenic effect was observed only at 2000mg/kg dose. On the other hand, in the both assays and all tested doses were observed a significant reduction of DNA damage and chromosomal aberrations in all groups co-treated with DXR and extract compared to those which received only DXR. These results indicate that Rubus niveus aerial parts extract did not revealed any genotoxic effect, but presented some aneugenic/clastogenic effect at higher dose; and suggest that it could be a potential adjuvant against development of second malignant neoplasms caused by the cancer chemotherapic DXR.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Association Between Parity, Pre-pregnancy Body Mass Index And Gestational Weight Gain.

To analyze the relationship between parity, pre-pregnancy body mass index (BMI), and gestational weight gain (GWG). This observational controlled study was conducted from November 2013 to April 2014, with postpartum women who started antenatal care up to 14 weeks and had full-term births. Data were collected from medical records and antenatal cards. Descriptive and bivariate analyses were performed. The significance level was 5%. Data were collected from 130 primiparous and 160 multiparous women. At the beginning of prenatal care, 54.62% of the primiparous were eutrophic, while the majority of multiparous were overweight or obese (62.51%). Multiparas are two times more likely to be obese at the beginning of their pregnancies, when compared to primiparas. The average pre-pregnancy weight and final pregnancy weight was significantly higher in multiparous, however, the mean GWG was higher among primiparous. We found an inverse correlation between parity and the total GWG, but initial BMI was significantly higher in multiparas. Nevertheless, monitoring of the GWG through actions that promote a healthier lifestyle is needed, regardless of parity and nutritional status, in order to prevent excessive GWG and postpartum weight retention and consequently inadequate pre-pregnancy nutritional status in future pregnancies.

Reduction Of Oxidative Damage And Inflammatory Response In The Diaphragm Muscle Of Mdx Mice Using Iron Chelator Deferoxamine.

Oxidative stress and inflammatory processes strongly contribute to pathogenesis in Duchenne muscular dystrophy (DMD). Based on evidence that excess iron may increase oxidative stress and contribute to the inflammatory response, we investigated whether deferoxamine (DFX), a potent iron chelating agent, reduces oxidative stress and inflammation in the diaphragm (DIA) muscle of mdx mice (an experimental model of DMD). Fourteen-day-old mdx mice received daily intraperitoneal injections of DFX at a dose of 150 mg/kg body weight, diluted in saline, for 14 days. C57BL/10 and control mdx mice received daily intraperitoneal injections of saline only, for 14 days. Grip strength was evaluated as a functional measure, and blood samples were collected for biochemical assessment of muscle fiber degeneration. In addition, the DIA muscle was removed and processed for histopathology and Western blotting analysis. In mdx mice, DFX reduced muscle damage and loss of muscle strength. DFX treatment also resulted in a significant reduction of dystrophic inflammatory processes, as indicated by decreases in the inflammatory area and in NF-κB levels. DFX significantly decreased oxidative damage, as shown by lower levels of 4-hydroxynonenal and a reduction in dihydroethidium staining in the DIA muscle of mdx mice. The results of the present study suggest that DFX may be useful in therapeutic strategies to ameliorate dystrophic muscle pathology, possibly via mechanisms involving oxidative and inflammatory pathways.

New Interaction Partners For Nek4.1 And Nek4.2 Isoforms: From The Dna Damage Response To Rna Splicing.

Neks are serine-threonine kinases that are similar to NIMA, a protein found in Aspergillus nidulans which is essential for cell division. In humans there are eleven Neks which are involved in different biological functions besides the cell cycle control. Nek4 is one of the largest members of the Nek family and has been related to the primary cilia formation and in DNA damage response. However, its substrates and interaction partners are still unknown. In an attempt to better understand the role of Nek4, we performed an interactomics study to find new biological processes in which Nek4 is involved. We also described a novel Nek4 isoform which lacks a region of 46 amino acids derived from an insertion of an Alu sequence and showed the interactomics profile of these two Nek4 proteins. Isoform 1 and isoform 2 of Nek4 were expressed in human cells and after an immunoprecipitation followed by mass spectrometry, 474 interacting proteins were identified for isoform 1 and 149 for isoform 2 of Nek4. About 68% of isoform 2 potential interactors (102 proteins) are common between the two Nek4 isoforms. Our results reinforce Nek4 involvement in the DNA damage response, cilia maintenance and microtubule stabilization, and raise the possibility of new functional contexts, including apoptosis signaling, stress response, translation, protein quality control and, most intriguingly, RNA splicing. We show for the first time an unexpected difference between both Nek4 isoforms in RNA splicing control. Among the interacting partners, we found important proteins such as ANT3, Whirlin, PCNA, 14-3-3ε, SRSF1, SRSF2, SRPK1 and hNRNPs proteins. This study provides new insights into Nek4 functions, identifying new interaction partners and further suggests an interesting difference between isoform 1 and isoform 2 of this kinase. Nek4 isoform 1 may have similar roles compared to other Neks and these roles are not all preserved in isoform 2. Besides, in some processes, both isoforms showed opposite effects, indicating a possible fine controlled regulation.

Spinal Cord Damage In Machado-joseph Disease.

Machado-Joseph disease (SCA3) is the most frequent spinocerebellar ataxia worldwide and characterized by remarkable phenotypic heterogeneity. MRI-based studies in SCA3 focused in the cerebellum and connections, but little is known about cord damage in the disease and its clinical relevance. To evaluate the spinal cord damage in SCA3 through quantitative analysis of MRI scans. A group of 48 patients with SCA3 and 48 age and gender-matched healthy controls underwent MRI on a 3T scanner. We used T1-weighted 3D images to estimate the cervical spinal cord area (CA) and eccentricity (CE) at three C2/C3 levels based on a semi-automatic image segmentation protocol. The scale for assessment and rating of ataxia (SARA) was employed to quantify disease severity. The two groups-SCA3 and controls-were significantly different regarding CA (49.5 ± 7.3 vs 67.2 ± 6.3 mm(2), p < 0.001) and CE values (0.79 ± 0.06 vs 0.75 ± 0.05, p = 0.005). In addition, CA presented a significant correlation with SARA scores in the patient group (p = 0.010). CE was not associated with SARA scores (p = 0.857). In the multiple variable regression, we found that disease duration was the only variable associated with CA (coefficient = -0.629, p = 0.025). SCA3 is characterized by cervical cord atrophy and antero-posterior flattening. In addition, the spinal cord areas did correlate with disease severity. This suggests that quantitative analyses of the spinal cord MRI might be a useful biomarker in SCA3.

Role Of The Different Sexuality Domains On The Sexual Function Of Women With Premature Ovarian Failure.

Women with premature ovarian failure (POF) often manifest complaints involving different aspects of sexual function (SF), regardless of using hormone therapy. SF involves a complex interaction between physical, psychological, and sociocultural aspects. There are doubts about the impact of different complaints on the global context of SF of women with POF. To evaluate the percentage of influence of each of the sexuality domains on the SF in women with POF. Cross-sectional study with 80 women with POF, matched by age to 80 women with normal gonadal function. We evaluated SF through the Female Sexual Function Index (FSFI), a comparison between the POF and control groups using the Mann-Whitney test. Component exploratory factor analysis was used to assess the proportional influence of each domain on the composition of the overall SF for women in the POF group. SF was evaluated using FSFI. Exploratory Factor Analysis for components was used to evaluate the role of each domain on the SF of women with POF. The FSFI score was significantly worse for women with POF, with a decrease in arousal, lubrication, orgasm, satisfaction, and dyspareunia. Exploratory factor analysis of SF showed that the domain with greater influence in the SF was arousal, followed by desire, together accounting for 41% of the FSFI. The domains with less influence were dyspareunia and lubrication, which together accounted for 25% of the FSFI. Women with POF have impaired SF, determined mainly by changes in arousal and desire. Aspects related to lubrication and dyspareunia complaints have lower determination coefficient in SF. These results are important in adapting the approach of sexual disorders in this group of women. Benetti-Pinto CL, Soares PM, Giraldo HPD, and Yela DA. Role of the different sexuality domains on the sexual function of women with premature ovarian failure. J Sex Med 2015;12:685-689.

Comparing Near-infrared Conventional Diffuse Reflectance Spectroscopy And Hyperspectral Imaging For Determination Of The Bulk Properties Of Solid Samples By Multivariate Regression: Determination Of Mooney Viscosity And Plasticity Indices Of Natural Rubber.

Conventional reflectance spectroscopy (NIRS) and hyperspectral imaging (HI) in the near-infrared region (1000-2500 nm) are evaluated and compared, using, as the case study, the determination of relevant properties related to the quality of natural rubber. Mooney viscosity (MV) and plasticity indices (PI) (PI0 - original plasticity, PI30 - plasticity after accelerated aging, and PRI - the plasticity retention index after accelerated aging) of rubber were determined using multivariate regression models. Two hundred and eighty six samples of rubber were measured using conventional and hyperspectral near-infrared imaging reflectance instruments in the range of 1000-2500 nm. The sample set was split into regression (n = 191) and external validation (n = 95) sub-sets. Three instruments were employed for data acquisition: a line scanning hyperspectral camera and two conventional FT-NIR spectrometers. Sample heterogeneity was evaluated using hyperspectral images obtained with a resolution of 150 × 150 μm and principal component analysis. The probed sample area (5 cm(2); 24,000 pixels) to achieve representativeness was found to be equivalent to the average of 6 spectra for a 1 cm diameter probing circular window of one FT-NIR instrument. The other spectrophotometer can probe the whole sample in only one measurement. The results show that the rubber properties can be determined with very similar accuracy and precision by Partial Least Square (PLS) regression models regardless of whether HI-NIR or conventional FT-NIR produce the spectral datasets. The best Root Mean Square Errors of Prediction (RMSEPs) of external validation for MV, PI0, PI30, and PRI were 4.3, 1.8, 3.4, and 5.3%, respectively. Though the quantitative results provided by the three instruments can be considered equivalent, the hyperspectral imaging instrument presents a number of advantages, being about 6 times faster than conventional bulk spectrometers, producing robust spectral data by ensuring sample representativeness, and minimizing the effect of the presence of contaminants.

Condutividade e difusividade térmica do figo (Ficus carica L.) Roxo de Valinhos

The post harvest cooling and/or freezing processes for horticultural products have been carried out with the objective of removing the heat from these products, allowing them a bigger period of conservation. Therefore, the knowledge of the physical properties that involve heat transference in the fig fruit Roxo de Valinhos is useful for calculating projects and systems of food engineering in general, as well as, for using in equations of thermodynamic mathematical models. The values of conductivity and thermal diffusivity of the whole fig fruit-rami index were determined, and from these values it was determined the value of the specific heat. For these determination it was used the transient method of the Line Heat Source. The results shown that the fig fruit has a thermal conductivity of 0.52 W m-1°C, thermal diffusivity of 1.56 x 10-7 m² s-1, pulp density of 815.6 kg m-3 and specific heat of 4.07 kJ kg-1 °C.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.