21 resultados para Coloração diferencial de Gram
Resumo:
One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.
Resumo:
The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The effects of aluminum (Al) on the activities of antioxidant enzymes and ferritin expression were studied in cell suspension cultures of two varieties of Coffea arabica, Mundo Novo and Icatu, in medium with pH at 5.8. The cells were incubated with 300 µM Al3+, and the Al speciation as Al3+ was 1.45% of the mole fraction. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione S-transferase (GST) were increased in Mundo Novo, whereas glutathione reductase (GR) and guaiacol peroxidase (GPOX) activities remained unchanged. SOD, GR, and GST activities were increased in Icatu, while CAT activity was not changed, and GPOX activity decreased. The expression of two ferritin genes (CaFer1 and CaFer2) were analyzed by Real-Time PCR. Al caused a downregulation of CaFER1 expression and no changes of CaFER2 expression in both varieties. The Western blot showed no alteration in ferritin protein levels in Mundo Novo and a decrease in Icatu. The differential enzymes responses indicate that the response to Al is variety-dependent.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física