Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Influence Of The Major Nitrite Transporter Nirc On The Virulence Of A Swollen Head Syndrome Avian Pathogenic E. Coli (apec) Strain.

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Surfactina: propriedades químicas, tecnológicas e funcionais para aplicações em alimentos

Surfactin, a lipopeptide produced by strains of Bacillus subtilis, has been proved to be a suitable biosurfactant in several applications. For many years, it has been investigated mainly for oil recovery and environmental usage. Its chemical, technological and functional characteristics turn surfactin into an attractive compound for several utilizations. In this review we emphasize some aspects of surfactin as a new food ingredient and its potential pharmaceutical and health applications.

Avaliação de estrutura de bambu como elemento construtivo para casa de vegetação

The use of technology to protect and produce vegetables and ornamental plants was developed over several adaptation phases that supported the demand for quality and amount of products. These developments also reduced production costs and climate damage to the crops. Many of these adaptations were carried out by farmers on their own initiative, using different materials and devices to solve their problems. This study was carried out at Agricultural Engineering College - Campinas University/UNICAMP, from December 2002 to January 2003, with the objective of evaluating the deformations of the constructive system of bamboo structure for greenhouses, submitted to different spacing among columns, and different vertical strains. It was tested the use of beams and columns built with bamboo stems from the specie Bambusa tuldoides Munro. The beams and columns were tied together with plastic spacing parts, specially designed to facilitate and standardize the construction of the building, providing more resistance and stability. Three column spaces (2.0, 2.5 and 3.0 m) were evaluated under different load strains. The best result was obtained with a spacing of 2.5 m.

Formação de conceitos em crianças cegas: questões teóricas e implicações educacionais

Concept formation depends on language and thought, that promote the integration of information coming from the senses. It is postulated that changes in the person, the objects and events to be known suggest flexible models of concept teaching. It is assumed that the same considerations apply to teaching concepts to blind pupils. Specificities of this process are discussed, including the role of touch as resource, although not as a direct substitute to vision, and the notion of representation as a basis for the elaboration of pedagogical resources for the blind student.

Ocorrência de fungos filamentosos termo-resistentes em polpa de tomate envasada assepticamente

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Evaluation of the cytotoxic and genotoxic potential of water from the River Paraíba do Sul, in Brazil, with the Allium cepa L. test

This work investigated the cytotoxic and genotoxic potential of water from the River Paraíba do Sul (Brazil) using Allium cepa roots. An anatomo-morphological parameter (root length), mitotic indices, and frequency of micronuclei were analysed. Eight bulbs were chosen at random for treatment for 24 to 120 hours with the River water collected in the years of 2005 and 2006 from sites in the cities of Tremembé and Aparecida (São Paulo state, Brazil). Daily measurements of the length of the roots grown from each bulb were carried out throughout the experiment. Mitotic index (MI) and frequency of micronuclei (MN) were determined for 2000 cells per root, using 3-5 root tips from other bulbs (7-10). Only in the roots treated with samples of the River water collected in 2005 in Tremembé city was there a decrease in the root length growth compared to the respective control. However, a reduction in MI values was verified for both sites analysed for that year. Considering the data involving root length growth and especially MI values, a cytotoxic potential is suggested for the water of the River Paraíba do Sul at Tremembé and Aparecida, in the year of 2005. On the other hand, since in this year the MN frequency was not affected with the river water treatments, genotoxicity is not assumed for the river water sampled at the aforementioned places.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Estudo da correlação entre coordenação motora e habilidades motoras de pessoas com sindrome de down

Universidade Estadual de Campinas . Faculdade de Educação Física

Corporeidade : quais são as concepções de corpo presentes nos discursos dos professores de educação fisica da rede municipal de ensino de Uberlandia

Universidade Estadual de Campinas. Faculdade de Educação Física

Dança... ensino, sentidos e possibilidades na escola

Universidade Estadual de Campinas. Faculdade de Educação Física

Resposta eletromiografica do musculo iliocostal lombar e abordagem da pressão intradiscal da coluna lombar

Universidade Estadual de Campinas. Faculdade de Educação Física

Acões motrizes e representações sociais no jogo do laço no vale do Itabapoana

Universidade Estadual de Campinas . Faculdade de Educação Física

Lazer, politica cultural e extensão universitaria no projeto de ensino, pesquisa e extensão : recreação comunitaria

Universidade Estadual de Campinas. Faculdade de Educação Física

Proposição, validação e aplicação de um novo metodo para analise cinematica tridimensional da movimentação da caixa toracica durante a respiração

Universidade Estadual de Campinas . Faculdade de Educação Física