21 resultados para Anti-LZP3-specific IgG
Resumo:
Crohn´s disease (CD) is a chronic transmural inflammation of the gastrointestinal tract of unknown cause. Malnutrition associated with active CD has been reduced although obesity has increased. Dietary strategies such as those with high-protein have been proposed to reduce body fat. This study compares the effects of two supplements on the nutritional status of CD patients. 68 CD patients were randomized in two groups: whey protein group (WP) and soy protein group (SP). Using bioimpedance analysis, anthropometry and albumin and pre-albumin dosages the nutritional status was measured before starting the intervention and after 8 and 16 weeks. The disease activity was determined by Crohn's Disease Activity Index and serum C-reactive protein dosage and dietary intake by 24h dietary recalls. Forty-one patients concluded the study and both supplements changed body composition similarly. Triceps skin fold thickness (p< 0.001) and body fat percentage (p=0.001) decreased, whereas mid-arm muscle circumference (p=0.004), corrected arm muscle area (p=0.005) and body lean percentage (p=0.001) increased. For Crohn's disease patients undergoing anti TNF-alpha and azatioprine therapies, supplementation with whey and soy proteins changes body composition through reduction of body fat and thus contributes to control inflammation.
Resumo:
The objective of this article is to examine the current government proposal of racialization in the Brazilian population, in order to offer support to affirmative action programs that meet the specific needs of those who classify themselves as black. Firstly we focused on the revival of the notion of race among scholars, politicians, and anti-racism activists, as well as on the difficulty in determining who is black in Brazil. Next we examined the racial quota system in the United States and its proclaimed success. Finally, we assessed the extent to which the introduction of racial quota in employment and university enrollment should be imposed as the sole political option for those intending to eliminate racism in Brazilian society.
Resumo:
High levels of substrate-based 1,5-stereoinduction are obtained in the boron-mediated aldol reactions of beta-oxygenated methyl ketones with achiral and chiral aldehydes. Remote induction from the boron enolates gives the 1,5-anti adducts, with the enolate pi-facial selectivity critically dependent upon the nature of the beta-alkoxy protecting group. This 1,5-anti aldol methodology has been strategically employed in the total synthesis of several natural products. At present, the origin of the high level of 1,5-anti induction obtained with the boron enolates is unclear, although a model based on a hydrogen bonding between the alkoxy oxygen and the formyl hydrogen has been recently proposed.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física