20 resultados para Adverse Drug Events


Relevância:

20.00% 20.00%

Publicador:

Resumo:

one hundred (n=100) elderly outpatients with diabetic retinopathy taking antihypertensives and/or oral antidiabetics/insulin were interviewed. Adherence was evaluated by the adherence proportion and its association with the care taken in administrating medications and by the Morisky Scale. The National Eye Institute Visual Functioning Questionnaire (NEI VFQ-25) was used to evaluate HRQoL. most (58%) reported the use of 80% or more of the prescribed dose and care in utilizing the medication. The item stopping the drug when experiencing an adverse event, from the Morisky Scale, explained 12.8% and 13.5% of the variability of adherence proportion to antihypertensives and oral antidiabetics/insulin, respectively. there was better HRQoL in the Color Vision, Driving and Social Functioning domains of the NEI VFQ-25. Individuals with lower scores on the NEI VFQ-25 and higher scores on the Morisky Scale presented greater chance to be nonadherent to the pharmacological treatment of diabetes and hypertension.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To verify the methods used by the clinical trials that assessed the effect of tactile/kinesthetic stimulation on weight gain in preterm infants and highlight the similarities and differences among such studies. This review collected studies from two databases, PEDro and PubMed, in July of 2014, in addition to bibliographies. Two researchers assessed the relevant titles independently, and then chose which studies to read in full and include in this review by consensus. Clinical trials that studied tactile stimulation or massage therapy whether or not associated with kinesthetic stimulation of preterm infants; that assessed weight gain after the intervention; that had a control group and were composed in English, Portuguese, or Spanish were included. A total of 520 titles were found and 108 were selected for manuscript reading. Repeated studies were excluded, resulting in 40 different studies. Of these, 31 met all the inclusion criteria. There were many differences in the application of tactile/kinesthetic stimulation techniques among studies, which hindered the accurate reproduction of the procedure. Also, many studies did not describe the adverse events that occurred during stimulation, the course of action taken when such events occurred, and their effect on the outcome. These studies made a relevant contribution towards indicating tactile/kinesthetic stimulation as a promising tool. Nevertheless, there was no standard for application among them. Future studies should raise the level of methodological rigor and describe the adverse events. This may permit other researchers to be more aware of expected outcomes, and a standard technique could be established.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The exchange of a prescribed drug by other similar, by generic products and even by custom products has become common practice in our country, often ignoring basic tenets of bioequivalence, interchangeability, stability and characteristics of the pharmaceutical compounds. In the case of drugs of narrow therapeutic index, such as levothyroxine, these problems are intensified, putting the effectiveness of treatment and patient health at serious risk. We review the pertinent legislation, emphasizing the characteristics of levothyroxine and adverse effects that limit the interchangeability of the compound.