17 resultados para sentimental novel Hispano-American


Relevância:

40.00% 40.00%

Publicador:

Resumo:

In this study, 103 unrelated South-American patients with mucopolysaccharidosis type II (MPS II) were investigated aiming at the identification of iduronate-2-sulfatase (IDS) disease causing mutations and the possibility of some insights on the genotype-phenotype correlation The strategy used for genotyping involved the identification of the previously reported inversion/disruption of the IDS gene by PCR and screening for other mutations by PCR/SSCP. The exons with altered mobility on SSCP were sequenced, as well as all the exons of patients with no SSCP alteration. By using this strategy, we were able to find the pathogenic mutation in all patients. Alterations such as inversion/disruption and partial/total deletions of the IDS gene were found in 20/103 (19%) patients. Small insertions/deletions/indels (<22 bp) and point mutations were identified in 83/103 (88%) patients, including 30 novel mutations; except for a higher frequency of small duplications in relation to small deletions, the frequencies of major and minor alterations found in our sample are in accordance with those described in the literature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The mechanism underlying castration-induced prostate regression, which is a classical physiological concept translated into the therapeutic treatment of advanced prostate cancer, involves epithelial cell apoptosis. In searching for events and mechanisms contributing to prostate regression in response to androgen modulation, we have frequently observed the collective deletion of epithelial cells. This work was undertaken to characterize this phenomenon hereafter named desquamation and to verify its presence after 17β-estradiol (E2) administration. Electron microscopy revealed that the desquamating cells had preserved cell-cell junctions and collapsed nuclear contents. The TUNEL reaction was negative for these cells, which were also negative for cleaved caspases-8, -9, -3 and nuclear apoptosis-inducing factor. Detailed analyses revealed that the condensed chromatin was first affected detaching from the nuclear lamina, which was observable after lamin A immunohistochemistry, suggesting the lack of lamin A degradation. A search in animals treated with supraphysiological E2 employed as an alternative anti-androgen treatment revealed no desquamation. The combined treatment (Cas + E2 group) caused changes particular to each treatment, including desquamation. In conclusion, desquamation appeared as a novel phenomenon contributing to collective prostate epithelial cell deletion, distinct from the classical castration-induced apoptosis and particular to the androgen deprivation resulting from surgical castration, and should be considered as part of the mechanisms promoting organ regression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In order to report the outcome of a patient who developed compartment syndrome after South American rattlesnake (Crotalus durissus terrificus) envenomation, confirmed by subfascial pressure measurement and magnetic resonance imaging (MRI). A 63-year-old male was admitted 1 h after being bitten on the right elbow by a large snake, which was not brought for identification. Physical and laboratory features upon admission revealed two fang marks, local tense swelling, paresthesia, intense local pain, hypertension, coagulopathy, and CK = 1530 U/L (RV < 170 U/L). The case was initially treated with bothropic antivenom (80 mL, intravenously), with no improvement. Evolution within 13-14 h post-bite revealed generalized myalgia, muscle weakness, palpebral ptosis, and severe rhabdomyolysis (CK = 126,160 U/L) compatible with envenoming by C. d. terrificus. The patient was then treated with crotalic antivenom (200 mL, intravenously), fluid replacement, and urine alkalinization. Twenty-four-hour post-bite MRI showed marked muscular edema in the anterior compartment of the right forearm, with a high subfascial pressure (40 mmHg) being detected 1 h later. ELISA of a blood sample obtained upon admission, before antivenom infusion, revealed a high serum concentration of C. d. terrificus venom. No fasciotomy was performed and the patient was discharged seven days later without sequelae. Snakebite by C. d. terrificus with subfascial venom injection may lead to increased intracompartmental pressure.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Congenital muscular dystrophy with laminin α2 chain deficiency (MDC1A) is one of the most severe forms of muscular disease and is characterized by severe muscle weakness and delayed motor milestones. The genetic basis of MDC1A is well known, yet the secondary mechanisms ultimately leading to muscle degeneration and subsequent connective tissue infiltration are not fully understood. In order to obtain new insights into the molecular mechanisms underlying MDC1A, we performed a comparative proteomic analysis of affected muscles (diaphragm and gastrocnemius) from laminin α2 chain-deficient dy(3K)/dy(3K) mice, using multidimensional protein identification technology combined with tandem mass tags. Out of the approximately 700 identified proteins, 113 and 101 proteins, respectively, were differentially expressed in the diseased gastrocnemius and diaphragm muscles compared with normal muscles. A large portion of these proteins are involved in different metabolic processes, bind calcium, or are expressed in the extracellular matrix. Our findings suggest that metabolic alterations and calcium dysregulation could be novel mechanisms that underlie MDC1A and might be targets that should be explored for therapy. Also, detailed knowledge of the composition of fibrotic tissue, rich in extracellular matrix proteins, in laminin α2 chain-deficient muscle might help in the design of future anti-fibrotic treatments. All MS data have been deposited in the ProteomeXchange with identifier PXD000978 (http://proteomecentral.proteomexchange.org/dataset/PXD000978).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Streptococcus sanguinis is a commensal pioneer colonizer of teeth and an opportunistic pathogen of infectious endocarditis. The establishment of S. sanguinis in host sites likely requires dynamic fitting of the cell wall in response to local stimuli. In this study, we investigated the two-component system (TCS) VicRK in S. sanguinis (VicRKSs), which regulates genes of cell wall biogenesis, biofilm formation, and virulence in opportunistic pathogens. A vicK knockout mutant obtained from strain SK36 (SKvic) showed slight reductions in aerobic growth and resistance to oxidative stress but an impaired ability to form biofilms, a phenotype restored in the complemented mutant. The biofilm-defective phenotype was associated with reduced amounts of extracellular DNA during aerobic growth, with reduced production of H2O2, a metabolic product associated with DNA release, and with inhibitory capacity of S. sanguinis competitor species. No changes in autolysis or cell surface hydrophobicity were detected in SKvic. Reverse transcription-quantitative PCR (RT-qPCR), electrophoretic mobility shift assays (EMSA), and promoter sequence analyses revealed that VicR directly regulates genes encoding murein hydrolases (SSA_0094, cwdP, and gbpB) and spxB, which encodes pyruvate oxidase for H2O2 production. Genes previously associated with spxB expression (spxR, ccpA, ackA, and tpK) were not transcriptionally affected in SKvic. RT-qPCR analyses of S. sanguinis biofilm cells further showed upregulation of VicRK targets (spxB, gbpB, and SSA_0094) and other genes for biofilm formation (gtfP and comE) compared to expression in planktonic cells. This study provides evidence that VicRKSs regulates functions crucial for S. sanguinis establishment in biofilms and identifies novel VicRK targets potentially involved in hydrolytic activities of the cell wall required for these functions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Resistant hypertension (RH) is a multifactorial disease, frequently associated with obesity and characterized by blood pressure above goal (140/90 mm Hg) despite the concurrent use of ≥3 antihypertensive drugs of different classes. The mechanisms of obesity-related hypertension include, among others, aldosterone excess and inflammatory adipokines, which have demonstrated a significant role in the pathogenesis of metabolic syndrome and RH. This review aims to summarize recent studies on the role of the adipokines leptin, resistin, and adiponectin in the pathophysiology of RH and target-organ damage associated with this condition. The deregulation of adipokine levels has been associated with clinical characteristics frequently recognized in RH such as diabetes, hyperactivity of sympathetic and renin-angiotensin-aldosterone systems, and vascular and renal damage. Strategies to regulate adipokines may be promising for the management of RH and some clinical implications must be considered when managing controlled and uncontrolled patients with RH.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Hevea brasiliensis is a native species of the Amazon Basin of South America and the primary source of natural rubber worldwide. Due to the occurrence of South American Leaf Blight disease in this area, rubber plantations have been extended to suboptimal regions. Rubber tree breeding is time-consuming and expensive, but molecular markers can serve as a tool for early evaluation, thus reducing time and costs. In this work, we constructed six different cDNA libraries with the aim of developing gene-targeted molecular markers for the rubber tree. A total of 8,263 reads were assembled, generating 5,025 unigenes that were analyzed; 912 expressed sequence tags (ESTs) represented new transcripts, and two sequences were highly up-regulated by cold stress. These unigenes were scanned for microsatellite (SSR) regions and single nucleotide polymorphisms (SNPs). In total, 169 novel EST-SSR markers were developed; 138 loci were polymorphic in the rubber tree, and 98 % presented transferability to six other Hevea species. Locus duplication was observed in H. brasiliensis and other species. Additionally, 43 SNP markers in 13 sequences that showed similarity to proteins involved in stress response, latex biosynthesis and developmental processes were characterized. cDNA libraries are a rich source of SSR and SNP markers and enable the identification of new transcripts. The new markers developed here will be a valuable resource for linkage mapping, QTL identification and other studies in the rubber tree and can also be used to evaluate the genetic variability of other Hevea species, which are valuable assets in rubber tree breeding.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A Bacillus cereus strain, FT9, isolated from a hot spring in the midwest region of Brazil, had its entire genome sequenced.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A series of novel 1-(substituted phenyl)-3-(2-oxo-1,3,4-oxadiazol-5-yl) β-carbolines (4a-e) and the corresponding Mannich bases 5-9(a-c) were synthesized and evaluated for their in vitro antitumor activity against seven human cancer cell lines. Compounds of 4a-e series showed a broad spectrum of antitumor activity, with GI50 values lower than 15μM for five cell lines. The derivative 4b, having the N,N-dimethylaminophenyl group at C-1, displayed the highest activity with GI50 in the range of 0.67-3.20μM. A high selectivity and potent activity were observed for some Mannich bases, particularly towards resistant ovarian (NCI-ADR/RES) cell lines (5a, 5b, 6a, 6c and 9b), and ovarian (OVCAR-03) cell lines (5b, 6a, 6c, 9a, 9b and 9c). In addition, the interaction of compound 4b with DNA was investigated by using UV and fluorescence spectroscopic analysis. These studies indicated that 4b interact with ctDNA by intercalation binding.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

American tegumentary leishmaniasis (ATL) is a disease transmitted to humans by the female sandflies of the genus Lutzomyia. Several factors are involved in the disease transmission cycle. In this work only rainfall and deforestation were considered to assess the variability in the incidence of ATL. In order to reach this goal, monthly recorded data of the incidence of ATL in Orán, Salta, Argentina, were used, in the period 1985-2007. The square root of the relative incidence of ATL and the corresponding variance were formulated as time series, and these data were smoothed by moving averages of 12 and 24 months, respectively. The same procedure was applied to the rainfall data. Typical months, which are April, August, and December, were found and allowed us to describe the dynamical behavior of ATL outbreaks. These results were tested at 95% confidence level. We concluded that the variability of rainfall would not be enough to justify the epidemic outbreaks of ATL in the period 1997-2000, but it consistently explains the situation observed in the years 2002 and 2004. Deforestation activities occurred in this region could explain epidemic peaks observed in both years and also during the entire time of observation except in 2005-2007.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Relationships among floral biology, floral micromorphology and pollinator behaviour in bird-pollinated orchids are important issues to understand the evolution of the huge flower diversity within Orchidaceae. We aimed to investigate floral mechanisms underlying the interaction with pollinators in two hummingbird-pollinated orchids occurring in the Atlantic forest. We assessed floral biology, nectar traits, nectary and column micromorphologies, breeding systems and pollinators. In both species, nectar is secreted by lip calli through spaces between the medial lamellar surfaces of epidermal cells. Such form of floral nectar secretion has not been previously described. Both species present functional protandry and are self-compatible yet pollinator-dependent. Fruit sets in hand-pollination experiments were more than twice those under natural conditions, evidencing pollen limitation. The absence of fruit set in interspecific crosses suggests the existence of post-pollination barriers between these synchronopatric species. In Elleanthus brasiliensis, fruits resulting from cross-pollination and natural conditions were heavier than those resulting from self-pollination, suggesting advantages to cross-pollination. Hummingbirds pollinated both species, which share at least one pollinator species. Species differences in floral morphologies led to distinct pollination mechanisms. In E. brasiliensis, attachment of pollinaria to the hummingbird bill occurs through a lever apparatus formed by an appendage in the column, another novelty to the knowledge of orchids. In E. crinipes, pollinaria attachment occurs by simple contact with the bill during insertion into the flower tube, which fits tightly around the bill. The novelties described here illustrate the overlooked richness in ecology and morphophysiology in Orchidaceae. This article is protected by copyright. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The syndrome of resistance to thyroid hormone (RTH β) is an inherited disorder characterized by variable tissue hyposensitivity to 3,5,30-l-triiodothyronine (T3), with persistent elevation of free-circulating T3 (FT3) and free thyroxine (FT4) levels in association with nonsuppressed serum thyrotropin (TSH). Clinical presentation is variable and the molecular analysis of THRB gene provides a short cut diagnosis. Here, we describe 2 cases in which RTH β was suspected on the basis of laboratory findings. The diagnosis was confirmed by direct THRB sequencing that revealed 2 novel mutations: the heterozygous p.Ala317Ser in subject 1 and the heterozygous p.Arg438Pro in subject 2. Both mutations were shown to be deleterious by SIFT, PolyPhen, and Align GV-GD predictive methods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Y-chromosome-located SRY gene encodes a small testis-specific protein containing a DNA-binding motif known as the HMG (high mobility group) box. However, mutations in SRY are not frequent especially in cases of 46,XY partial gonadal dysgenesis. Several sex-determining genes direct the fate of the bipotential gonad to either testis or ovary. In addition, heterozygous small deletions in 9p can cause complete and partial XY gonadal dysgenesis without other symptoms. Human DMRT1 gene, which is located at 9p24.3, is expressed in testis and ovary and has been considered, among others, a candidate autosomal gene responsible for gonadal dysgenesis. In this report we describe a nucleotide insertion in DMRT1 3'UTR in a patient of XY partial gonadal dygenesis. The 3'UTR+11insT is located within a conserved motif important for mRNA stabilization.