42 resultados para relação de escala


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The chronic treatment with phenytoin or the acute intoxication by this drug may cause permanent cerebellar injury with atrophy of cerebellum vermis and hemispheres, which can be detected by neuroimaging studies. The aim of the present study was to investigate the correlation between the dosage and duration of treatment with phenytoin and the occurrence of cerebellar atrophy. Sixty-six patients were studied and had their tomographies analyzed for cerebellar atrophy. Of the 66 patients studied, 18 had moderate/severe atrophy, 15 had mild atrophy and 33 were considered to be normal. The patients with moderate/severe atrophy were those with higher exposure to phenytoin (longer duration of treatment and higher total dosage) showing statistically significant difference when compared to patients with mild atrophy or without atrophy (p=0.02). Further, the patients with moderate/severe atrophy had serum levels of phenytoin statistically higher than those of patients with mild atrophy or without atrophy (p = 0.008). There was no association between other antiepileptic drugs dosage or duration of treatment and degree of cerebellar atrophy. We also found that older patients had cerebellar atrophy more frequently, indicating that age or duration of the seizure disorder may also be important in the determination of cerebellar degeneration in these patients. We conclude that although there is a possibility that repeated seizures contribute to cerebellar damage, long term exposure to phenytoin, particularly in high doses and toxic serum levels, cause cerebellar atrophy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The copper and cadmium complexation properties in natural sediment suspensions of reservoirs of the Tietê River were studied using the solid membrane copper and cadmium ion-selective electrodes. The complexation and the average conditional stability constants were determined under equilibrium conditions at pH=6.00 ± 0.05 in a medium of 1.0 mol L-1 sodium nitrate, using the Scatchard method. The copper and cadmium electrodes presented Nernstian behavior from 1x10-6 to 1x10-3 mol L-1 of total metal concentration. Scatchard graphs suggest two classes of binding sites for both metals. A multivariate study was done to correlate the reservoirs and the variables: complexation properties, size, total organic carbon, volatile acid sulfide, E II and pH.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Multidrug resistance, MDR is a major obstacle for cancer chemotherapy. MDR can be reversed by drugs that vary in their chemical structure and main biological activity. Many efforts have been done to overcome MDR based on studies of structure-activity relationships and in this review we summarize some aspects of MDR mediated by P-glycoprotein (P-gp), as the most experimentally and clinically tested form of drug resistance. The most significant MDR mechanisms revealed until now are shortly discussed. Physicochemical and structural properties of MDR modulators, measures of the MDR reversal, and QSAR studies are included.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Brazil is an important poultry meat export country, and large parts of its destination are countries with specific rearing restrictions related to broiler s welfare. One of the aerial pollutants mostly found in high concentrations in closed poultry housing environment is ammonia. There are evidences that broilers welfare may be compromised by the continuous exposition to this pollutant in rearing housing. This research aimed to estimate broilers welfare reared under specific thermal environmental attributes and bird s density, as function of the ammonia concentration and light intensity inside the housing environment using the Fuzzy Theory. Results showed that the best welfare value (0.89 in the scale: 0-1) approximately 90% of the ideal was found in the conditions that associated the ideal thermal environment, with bird s density between 13-15 birds m-2, with values of the ammonia concentration in the environment below 5 ppm, and light intensity near 1 lx. Using the predictive method it was possible to estimate broilers welfare with relation to the ammonia concentration and light intensity in the housing.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main objective of this work was to evaluate the linear regression between spectral response and soybean yield in regional scale. In this study were monitored 36 municipalities from the west region of the states of Parana using five images of Landsat 5/TM during 2004/05 season. The spectral response was converted in physical values, apparent and surface reflectances, by radiometric transformation and atmospheric corrections and both used to calculate NDVI and GVI vegetation indices. Those ones were compared by multiple and simple regression with government official yield values (IBGE). Diagnostic processing method to identify influents values or collinearity was applied to the data too. The results showed that the mean surface reflectance value from all images was more correlated with yield than individual dates. Further, the multiple regressions using all dates and both vegetation indices gave better results than simple regression.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this study was to conduct an exploratory factorial analysis of Problems in School, a teachers' motivational styles evaluation instrument, constructed by Deci et al. The original instrument is in a Likert-scale format with the underlying assumption of the existence of a continuum of four different styles contributing to promote students' autonomy. Translated into portuguese, the instrument was applied to 582 elementary and junior high school teachers from several regions of Brazil. Factorial analyses revealed a solution with four orthogonal distinct factors, the authors' initial supposition (existence of a continuum) was not confirmed. In fact, only two opposite styles (both high promotion of autonomy and of control) corresponded to the Deci et al. original ideas. Problems regarding the validity of the other remaining styles emerged. Data was discussed and a revised version of the scale was developed. Directions for further research were also suggested.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although learning strategies are important tools for schooling process, there is a lack of national instruments to evaluate their knowledge by brazilian students. Therefore, the objectives of this paper are to describe the steps necessary for the construction of a scale to evaluate the learning strategies for basic education students and to present the preliminary study of its psychometric properties. It is also discussed the utility of this instrument for diagnosis, intervention and prevention in school and educational psychology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of the present study was to verify the factorial validity of a learning strategy scale as well as to explore the concurrent validity of the instrument in regard to students´ academic achievement. The sample was composed of 815 basic education children from both public and private schools of São Paulo and Minas Gerais. The Learning Strategy Scale was collectively applied. Exploratory factorial analyses were conducted to achieve the purposes of the study. The alphas of Cronbach of the instrument and of its three subscales showed good reliability. Variance analyses showed significant differences between school achievement and punctuation in the scale. The data were discussed in terms of their possible implications for the psycho-educational evaluation area.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work proposes to determine the water activity and the freezing point depression of tangerine, pineapple and lemon juices at various concentrations (10-55oBrix) and to achieve a correlation between these properties. The freezing point depression was determined with a LAKTRON cryoscope and common laboratory materials. The water activity was determined with a DECAGON CX-2 hygrometer in the temperature range of 15 to 30oC. With the results, the adjustment to CHEN (1987) water activity prediction equation to non-electrolyte mixtures was verified, through the calculation of the variation coefficient (CV). Being CV smaller than 3% for the proposed model, it can be said that the experimental data have adjusted well to the prediction equation. The water activity and the freezing point depression was correlated for tangerine, pineapple and lemon juices and r2 values were higher than 99%. Therefore, it is possible to obtain the water activity by knowing the freezing point depression of studied juices.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose: To evaluate the onset time and quality of peribulbar anesthesia with 1% ropivacaine associated or not with hyaluronidase 100 tru/ml for cataract extraction. Methods: Prospective, randomized, double-blind and controlled study including fifty-seven patients, scheduled to undergo peribulbar anesthesia for cataract extraction, allocated to two groups. Group C: 1% ropivacaine with addition of 100 tru/ml hyaluronidase, and Group S 1% ropivacaine, without hyaluronidase. The onset time for globe akinesia was studied at intervals of 2 minutes, using Nicoll's score. We evaluated pain by analogic score during the surgery and the necessity of complementing the anaesthesia. The peribulbar block was considered satisfactory when the Nicoll's score was less than 4. Results: The mean time of onset of block in group C was 4.07 minutes (± 3.24), and in group S 5.03 (± 3.28). There was no statistically significant difference between the groups. Both were similar regarding pain score, no pain was observed in 57.14% of group C, and in 68.97% of group S. The supplementary anesthetic was necessary in 2 cases of group C and in 3 cases of group S. Two cases of bradycardia (heart rate < 50 bpm) were observed during the surgery, and in one case administration of atropine IV was necessary. Conclusion: 1% ropivacaine provided a good quality of anesthesia for cataract extraction, with a faster onset of action in the group with hyaluronidase 100 iu/ml, although without significant difference.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física