16 resultados para linhagem celular
Resumo:
36
Resumo:
Behavioral adjustments may occur fast and with less cost than the physiological adaptations. Considering the social behavior is suggestive that the frequency and the intensity of aggressive interactions, the total social cohesion and the extent of vicious attitudes may be used to evaluate welfare. This research presents an analysis of the interactions between the experimental factors such as temperature, genetic and time of the day in the behavior of female broiler breeders under controlled environment in a climatic chamber in order to enhance the different reaction of the birds facing distinct environmental conditions. The results showed significant differences between the behaviors expressed by the studied genetics presenting the need of monitoring them in real-time in order to predict their welfare in commercial housing, due to the complexity of the environmental variables that interfere in the well being process. The research also concluded that the welfare evaluation of female broiler breeders needs to consider the time of the day during the observation of the behaviors.
Resumo:
A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.
Resumo:
Cyclosporine, a drug used in immunosuppression protocols for hematopoietic stem cell transplantation that has a narrow therapeutic index, may cause various adverse reactions, including nephrotoxicity. This has a direct clinical impact on the patient. This study aims to summarize available evidence in the scientific literature on the use of cyclosporine in respect to its risk factor for the development of nephrotoxicity in patients submitted to hematopoietic stem cell transplantation. A systematic review was made with the following electronic databases: PubMed, Web of Science, Embase, Scopus, CINAHL, LILACS, SciELO and Cochrane BVS. The keywords used were: bone marrow transplantation OR stem cell transplantation OR grafting, bone marrow AND cyclosporine OR cyclosporin OR risk factors AND acute kidney injury OR acute kidney injuries OR acute renal failure OR acute renal failures OR nephrotoxicity. The level of scientific evidence of the studies was classified according to the Oxford Centre for Evidence Based Medicine. The final sample was composed of 19 studies, most of which (89.5%) had an observational design, evidence level 2B and pointed to an incidence of nephrotoxicity above 30%. The available evidence, considered as good quality and appropriate for the analyzed event, indicates that cyclosporine represents a risk factor for the occurrence of nephrotoxicity, particularly when combined with amphotericin B or aminoglycosides, agents commonly used in hematopoietic stem cell transplantation recipients.
Resumo:
The purpose of this study was to evaluate the effectiveness of mature red cell and reticulocyte parameters under three conditions: iron deficiency anemia, anemia of chronic disease, and anemia of chronic disease associated with absolute iron deficiency. Peripheral blood cells from 117 adult patients with anemia were classified according to iron status, and inflammatory activity, and the results of a hemoglobinopathy investigation as: iron deficiency anemia (n=42), anemia of chronic disease (n=28), anemia of chronic disease associated with iron deficiency anemia (n=22), and heterozygous β thalassemia (n=25). The percentage of microcytic red cells, hypochromic red cells, and levels of hemoglobin content in both reticulocytes and mature red cells were determined. Receiver operating characteristic analysis was used to evaluate the accuracy of the parameters in differentiating between the different types of anemia. There was no significant difference between the iron deficient group and anemia of chronic disease associated with absolute iron deficiency in respect to any parameter. The percentage of hypochromic red cells was the best parameter to discriminate anemia of chronic disease with and without absolute iron deficiency (area under curve=0.785; 95% confidence interval: 0.661-0.909, with sensitivity of 72.7%, and specificity of 70.4%; cut-off value 1.8%). The formula microcytic red cells minus hypochromic red cells was very accurate in differentiating iron deficiency anemia and heterozygous β thalassemia (area under curve=0.977; 95% confidence interval: 0.950-1.005; with sensitivity of 96.2%, and specificity of 92.7%; cut-off value 13.8). The indices related to red cells and reticulocytes have a moderate performance in identifying absolute iron deficiency in patients with anemia of chronic disease.
Resumo:
Although myelodysplastic syndromes have a clear definition in theory, the morphologic dysplasia associated with ineffective hematopoiesis may be subtle and difficult to recognize and can commonly be mimicked by systemic conditions, such as infections, autoimmune disorders, nutritional deficiencies, toxic factors and non-hematological malignancies. However, myelodysplastic syndromes may truly coexist with other systemic diseases, which can be masked when the patient's symptoms are attributed exclusively to myelodysplastic syndromes without further investigation. To better illustrate this, we herein describe two cases associated with synchronous gastric cancers.
Resumo:
To report on the use of chronic myeloid leukemia as a theme of basic clinical integration for first year medical students to motivate and enable in-depth understanding of the basic sciences of the future physician. During the past thirteen years we have reviewed and updated the curriculum of the medical school of the Universidade Estadual de Campinas. The main objective of the new curriculum is to teach the students how to learn to learn. Since then, a case of chronic myeloid leukemia has been introduced to first year medical students and discussed in horizontal integration with all themes taught during a molecular and cell biology course. Cell structure and components, protein, chromosomes, gene organization, proliferation, cell cycle, apoptosis, signaling and so on are all themes approached during this course. At the end of every topic approached, the students prepare in advance the corresponding topic of clinical cases chosen randomly during the class, which are then presented by them. During the final class, a paper regarding mutations in the abl gene that cause resistance to tyrosine kinase inhibitors is discussed. After each class, three tests are solved in an interactive evaluation. The course has been successful since its beginning, 13 years ago. Great motivation of those who participated in the course was observed. There were less than 20% absences in the classes. At least three (and as many as nine) students every year were interested in starting research training in the field of hematology. At the end of each class, an interactive evaluation was performed and more than 70% of the answers were correct in each evaluation. Moreover, for the final evaluation, the students summarized, in a written report, the molecular and therapeutic basis of chronic myeloid leukemia, with scores ranging from 0 to 10. Considering all 13 years, a median of 78% of the class scored above 5 (min 74%-max 85%), and a median of 67% scored above 7. Chronic myeloid leukemia is an excellent example of a disease that can be used for clinical basic integration as this disorder involves well known protein, cytogenetic and cell function abnormalities, has well-defined diagnostic strategies and a target oriented therapy.
Resumo:
The study of female broiler breeders is of great importance for the country as poultry production is one of the largest export items, and Brazil is the second largest broiler meat exporter. Animal behavior is known as a response to the effect of several interaction factors among them the environment. In this way the internal housing environment is an element that gives hints regarding to the bird s thermal comfort. Female broiler breeder behavior, expresses in form of specific pattern the bird s health and welfare. This research had the objective of applying predictive statistical models through the use of simulation, presenting animal comfort scenarios facing distinct environmental conditions. The research was developed with data collected in a controlled environment using Hybro - PG® breeding submitted to distinct levels of temperature, three distinct types of standard ration and age. Descriptive and exploratory analysis were proceeded, and afterwards the modeling process using the Generalized Estimation Equation (GEE). The research allowed the development of the thermal comfort indicators by statistical model equations of predicting female broiler breeder behavior under distinct studied scenarios.
Resumo:
This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física