23 resultados para fungo termo-resistente


Relevância:

100.00% 100.00%

Publicador:

Resumo:

This work aimed at determining the occurrence of heat resistant molds during the aseptic processing of tomato pulp (8° BRIX). During tomato harvest, 9 lots were sampled (3 at the beginning, 3 at the apex and 3 at the end of harvest) and other 5 lots were sampled between harvest. For each lot, the enumeration of heat resistant molds was carried out in samples collected during the aseptic process. The mean count of heat resistant molds was relatively low, ranging from <1 to 8CFU/100mL of sample. The higher counts were observed in the raw material and the pre-wash and transportation water. Fifty strains of heat resistant molds detected in the enumeration procedure were isolated, codified and stocked. One-month-old spores of each isolate were submitted to different heat shocks to select the most heat resistant mold. The most heat resistant isolated strain (survived 100° C/25 minutes) was identified as Neosartorya fischeri.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Video-polygraphic-EEG studies were performed in the first 24 life-hours of 26 healthy full-term newborns without perinatal injuries. The neurological examination and cranial ultrasonography were normal. The newborns were divided into two groups: one, with full-term appropriate - birth weight 11 newborns (control group ) and the other with full-term low-birth weight 15 newborns. Thirteen newborns of the second group had video-polygraphic-EEG study abnormalities. The most frequent abnormalities were found in 11 cases, as far as sleep architecture is concerned. Also, when compared with the control group, 8 cases of an excessive amount of startles and 2 cases of low behavior activities were found. The results demonstrate the usefulness of video-polygraphic-EEG study in the full-term newborns with intra-uterine growth retard. This examination was sensitive to detect behavior, sleep architecture and EEG standard differences in the low birth-weight newborns as to the control group.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Thermosensitive hydrogels were synthesized using alginate-Ca2+ in association with a thermosensitive polymer, such as PNIPAAm. The mechanical properties of the hydrogels were determined measuring the maximum tension of deformation. With the increase of the temperature by 25 to 40 ºC above the LCST the chains of PNIPAAm collapsed, dragging the alginate net and diminishing the size of the pores. The decrease in the size of the pores of the hydrogel was followed by an increase in the mechanicals resistance of the material.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The authors analysed 34 cases of resistant epilepsy (20 males and 14 females, mean age 23 years), treated clinically between February/1984 and May/1986. The patients underwent neurological, neuropsychological, psychological, psychiatric, cerebrospinal fluid, electroencephalographic, tomographic and/or angiographic examination. Most of the patients had complex partial seizures. The etiology was unknown in 19 patients (55.8%), probable neurocysticercosis in 6, perinatal hypoxia in 5, delivery trauma in 3 and probable sequelae of encephalitis in 2 patients. There was a clear past history of infantile febrile convulsion in 2 patients. Most patients received carbamazepine (mean dose 24.5 mg/kg/day), phenytoin (5 mg/kg and valproic acid (28 mg/kg) as monotherapy or in association. Twenty-two patients (64.7%) had more than 80% decrease of the seizure frequency. Nine resistant epilepsy-cases (24.5%) were evaluated as candidates for surgical therapy. The authors concluded that the resistant epilepsy is best managed by a specialised, multidisciplinary team, and pointed out the need of a correct diagnosis of the seizure type, an adequate drug therapy and a good engagement of the patient and his family in the treatment.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Resistant hypertension (RHTN) is a multifactorial disease characterized by blood pressure (BP) levels above goal (140/90 mmHg) in spite of the concurrent use of three or more antihypertensive drugs of different classes. Moreover, it is well known that RHTN subjects have high prevalence of left ventricular diastolic dysfunction (LVDD), which leads to increased risk of heart failure progression. This review gathers data from studies evaluating the effects of phosphodiesterase-5 (PDE-5) inhibitors (administration of acute sildenafil and short-term tadalafil) on diastolic function, biochemical and hemodynamic parameters in patients with RHTN. Acute study with sildenafil treatment found that inhibition of PDE-5 improved hemodynamic parameters and diastolic relaxation. In addition, short-term study with the use of tadalafil demonstrated improvement of LVDD, cGMP and BNP-32 levels, regardless of BP reduction. No endothelial function changes were observed in the studies. The findings of acute and short-term studies revealed potential therapeutic effects of IPDE-5 drugs on LVDD in RHTN patients.A Hipertensão arterial resistente (HAR) é uma doença multifatorial caracterizada por níveis pressóricos acima das metas (140/90 mmHg), a despeito de tratamento farmacológico otimizado de 3 ou mais fármacos anti-hipertensivos de diferentes classes. Pacientes diagnosticados como hipertensos resistentes apresentam alta prevalência de disfunção diastólica do ventrículo esquerdo (DDVE) que proporciona risco aumentado para insuficiência cardíaca. Esta revisão reúne dados de estudos prévios avaliando os efeitos dos inibidores de fosfodiesterase-5 (PDE-5) (administração aguda de sildenafil e de curto prazo de tadalafil) na função diastólica e nos parâmetros bioquímicos e hemodinâmicos em pacientes com HAR. O estudo agudo com sildenafil demonstrou que a inibição da PDE-5 melhorou os parâmetros hemodinâmicos e de relaxamento diastólico. Além disso, o estudo curto prazo com o uso de tadalafil revelou melhora da DDVE e dos níveis de GMPc e BNP-32, independente de redução de pressão arterial. A função endotelial não apresentou alteração com ambos os tratamentos. Os resultados dos estudos agudo e de curto prazo sugerem efeitos terapêuticos potenciais dos fármacos inibidores da PDE-5 na disfunção diastólica em pacientes com HAR.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We evaluated children in the first grade of a elementary school using neurological examination. With no previous knowledgement of their educational performance, were invited all children attending five classes of the first grade of an elementary public school chosen randomly, in Itatiba / Sao Paulo / Brazil, whose parents assigned a Commitment Term for participation in this research. Children who missed three evaluations in different days or whose parents did not assigned the Commitment Term were excluded. The Traditional Neurological Examination (ENT) (Lefevre, 1972) was applied. It was considered for normal the measurement of the skull circumference, proposed by Diament & Rodrigues (1976), and the application of all ENT items. The data were stored in a database of the Epi6 Program (Epidemiologic Information), and analyzed by percentage calculation and by the c2 test. The significance level was 0.05. Children evaluated were 124. The ENT results were normal in 87 (70.16%) and altered in 37 (29.83%). Among the alterations, there were observed: light tremor, light muscular hypotonia, speech acquisition delay, macrocephaly, microcephaly, hyperactivity, cranial nerve syndrome, central facial paralysis. One child presented corticospinal tract impairment syndrome of the distal lower extremities.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The Orchidaceae is one of the largest flowering plants family and with a great importance to conservation. However, no survey on orchid flowers can be found in Mato Grosso do Sul. Thus, the objective of this work was to make a survey of the Orchidaceae species and of its ecology features in a riparian forest in a fragment of Floresta Estacional Semi-Decidual that belongs to the riparian forest of the Dourados River. The inventory was made by using a sweeping method for collection, and in addition to this the vertical and horizontal position of epiphytes were assessed on the hosts. For characterization of microclimate, it was used a thermohygrometer and luximeter. It was identified 17 species of 13 genera. Of the listed genera, the most abundant ones were: Acianthera, Macradenia and Capanemia. It was also noted a vertical and horizontal distribution of the Orchidaceae in relation to inverse gradient of water and light availability. Some species tended to be sensitive to height level categorization, whereas others seemed to occur with similar frequency along the host. In relation to the cardinal orientation, the apparent preferential response for south and east directions was associated to the low sampling effort and lower water availability, which could occur because the north face is opposed to the water body.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This article shows that the term functionalism, very often understood as a single or uniform approach in linguistics, has to be understood in its different perspectives. I start by presenting an opposing conception similar to the I-language vs E-language in Chomsky (1986). As in the latter conception , language can be understood as an abstract model of a mind internal mechanism responsible for language production and perception or, as in the former one, it can be the description of the external use of language. Also like with formalists , there are functionalists who look for cross-linguistic variation (and universals of language use) and functionalists who look for language internal variation. It is also shown that functionalists can differ in the extent to which social variables are considered in the explanation of linguistic form.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

OBJECTIVE: To characterize the behavior of premature newborns in the first year of chronological age. METHODS: This is a cross-sectional descriptive study, bound to a longitudinal study titled: Comparison of visual behavior on the first quarter of year of life of premature nursling born at two maternities of Recife/PE. The sample was composed by 52 premature newborns selected from June, 2007 to June, 2008 from the Maternity of the Federal University of Pernambuco (UFPE). Biological, socioeconomic and demographic data was collected through medical records and interviews with progeny. Newborns were evaluated by the Assessment Guide of Visual Ability in Infants. RESULTS: Most of the newborns were male at a gestational period between 33 weeks and 36 weeks and 6 days, showed a good visual behavior development for the age researched, and most of the families showed good socioeconomical and demographic profile. Besides, it was possible to detect ocular signs in 19% of sample, that were referred to an Ophthalmology Service. CONCLUSION: This study results point out the method like an important key in the early detection and visual screening for premature nursling since the first month of life and it led us to believe that clinical view for occupational therapy intervention must be focused not only on biological risks but also at the influence environment in newborn performance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física