17 resultados para What-if Analysis
Resumo:
The Ophira Mini Sling System involves anchoring a midurethral, low-tension tape to the obturator internus muscles bilaterally at the level of the tendinous arc. Success rates in different subsets of patients are still to be defined. This work aims to identify which factors influence the 2-year outcomes of this treatment. Analysis was based on data from a multicenter study. Endpoints for analysis included objective measurements: 1-h pad-weight (PWT), and cough stress test (CST), and questionnaires: International Consultation on Incontinence Questionnaire-Short Form (ICIQ-SF) and Urinary Distress Inventory (UDI)-6. A logistic regression analysis evaluated possible risk factors for failure. In all, 124 female patients with stress urinary incontinence (SUI) underwent treatment with the Ophira procedure. All patients completed 1 year of follow-up, and 95 complied with the 2-year evaluation. Longitudinal analysis showed no significant differences between results at 1 and 2 years. The 2-year overall objective results were 81 (85.3%) patients dry, six (6.3%) improved, and eight (8.4%) incontinent. A multivariate analysis revealed that previous anti-incontinence surgery was the only factor that significantly influenced surgical outcomes. Two years after treatment, women with previous failed surgeries had an odds ratio (OR) for treatment failure (based on PWT) of 4.0 [95% confidence interval (CI) 1.02-15.57). The Ophira procedure is an effective option for SUI treatment, with durable good results. Previous surgeries were identified as the only significant risk factor, though previously operated patients showed an acceptable success rate.
Resumo:
The aim of this retrospective study was to compare the peculiarities of maxillofacial injuries caused by interpersonal violence with other etiologic factors. Medical records of 3,724 patients with maxillofacial injuries in São Paulo state (Brazil) were retrospectively analyzed. The data were submitted to statistical analysis (simple descriptive statistics and Chi-squared test) using SPSS 18.0 software. Data of 612 patients with facial injuries caused by violence were analyzed. The majority of the patients were male (81%; n = 496), with a mean age of 31.28 years (standard deviation of 13.33 years). These patients were more affected by mandibular and nose fractures, when compared with all other patients (P < 0.01), although fewer injuries were recorded in other body parts (χ(2) = 17.54; P < 0.01); Victims of interpersonal violence exhibited more injuries when the neurocranium was analyzed in isolation (χ(2) = 6.85; P < 0.01). Facial trauma due to interpersonal violence seem to be related to a higher rate of facial fractures and lacerations when compared to all patients with facial injuries. Prominent areas of the face and neurocranium were more affected by injuries.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
PURPOSE: To evaluate the knowledge glaucoma patients have about their disease and its treatment. METHODS: One hundred and eighty-three patients were interviewed at the Glaucoma Service of Wills Eye Hospital (Philadelphia, USA, Group 1) and 100 at the Glaucoma Service of University of Campinas (Campinas, Brazil, Group 2). An informal, relaxed atmosphere was created by the interviewer before asking a list of 18 open-ended questions. RESULTS: In Group 1, 44% of the 183 patients did not have an acceptable idea about what glaucoma is, 30% did not know the purpose of the medications they were taking, 47% were not aware of what was an average intraocular pressure, and 45% did not understand why visual fields were examined. In Group 2, 54% gave unsatisfactory answers to the question What is glaucoma?, 54% did not know the purpose of the medications they were taking, 80% were not aware of what was an average intraocular pressure, and 94% did not understand why visual fields were examined (p<0.001). Linear regression analysis demonstrated that level of education was positively correlated to knowledge about glaucoma in both groups (r=0.65, p=0.001). CONCLUSION: This study showed that patients' knowledge about glaucoma varies greatly, and that in an urban, American setting, around one third of the patients have minimal understanding, whereas in an urban setting in Brazil around two thirds of patients were lacking basic information about glaucoma. Innovative and effective methods are needed to correct this situation.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física