41 resultados para Specific Learning Disabilities


Relevância:

80.00% 80.00%

Publicador:

Resumo:

Background/Aims. Studies on 46,XY partial gonadal dysgenesis (PGD) have focused on molecular, gonadal, genital, and hormone features; little is known about follow-up. Our aim was to analyze long-term outcomes of PGD. Methods. Retrospective longitudinal study conducted at a reference service in Brazil. Ten patients were first evaluated in the 1990s and followed up until the 2010s; follow-up ranged from 13.5 to 19.7 years. All were reared as males and had at least one scrotal testis; two bore NR5A1 mutations. Main outcomes were: associated conditions, pubertal development, and growth. Results. All patients had normal motor development but three presented cognitive impairment; five had various associated conditions. At the end of the prepubertal period, FSH was high or high-normal in 3/6 patients; LH was normal in all. At the last evaluation, FSH was high or high-normal in 8/10; LH was high or high-normal in 5/10; testosterone was decreased in one. Final height in nine cases ranged from -1.57 to 0.80 SDS. All had spontaneous puberty; only one needed androgen therapy. Conclusions. There is good prognosis for growth and spontaneous pubertal development but not for fertility. Though additional studies are required, screening for learning disabilities is advisable.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A literature review was conducted aiming to understand the interface between the Intellectual Disability and Mental Health fields and to contribute to mitigating the path of institutionalizing individuals with intellectual deficiencies. The so-called dual diagnosis phenomenon remains underestimated in Brazil but is the object of research and specific public policy internationally. This phenomenon alerts us to the prevalence of mental health problems in those with intellectual disabilities, limiting their social inclusion. The findings reinforce the importance of this theme and indicate possible diagnostic invisibility of the development of mental illness in those with intellectual disabilities in Brazil, which may contribute to sustaining psychiatric institutionalization of this population. 

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Reasons for the iniquities of caries, globally recognized, may be related to how Cariology has been taught in dental schools. In Brazil, the most important universities, when considering healthcare teaching, are the public ones. The objective of this study was to identify the insertion of the contents of Cariology in the course flowcharts of public dental schools in the country. The survey was conducted in 2013 seeking to identify the realities of different geographical regions, aimed to the census of public dental schools. It was performed a documentary analysis of the menus of disciplines, identifying the following issues: number of dental schools that include content related to Cariology in their curricula; average total workload undergraduate courses and disciplines that contemplate the theme; distribution of disciplines in professional training cycles (basic, clinical and public health); existence of discipline and/or a specific department; verification of bibliographic indication directly related to Cariology. The response rate was 93.6%. All dental schools recommended specific books, and none of them had a Department of Cariology. All dental schools in the country contemplated content related to Cariology in their disciplines, distributed in specific disciplines (except for the Northern region) and disciplines in the three cycles of learning (basic, clinical and public health), with larger workload in the clinical cycle. Although public dental schools in Brazil demonstrated commitment to contemplating the content related to Cariology in their disciplines, the emphasis on the clinical cycle may not be promoting the integrated formation of students, which could be contributing to reflect the inequalities of the disease in the country.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ecological science contributes to solving a broad range of environmental problems. However, lack of ecological literacy in practice often limits application of this knowledge. In this paper, we highlight a critical but often overlooked demand on ecological literacy: to enable professionals of various careers to apply scientific knowledge when faced with environmental problems. Current university courses on ecology often fail to persuade students that ecological science provides important tools for environmental problem solving. We propose problem-based learning to improve the understanding of ecological science and its usefulness for real-world environmental issues that professionals in careers as diverse as engineering, public health, architecture, social sciences, or management will address. Courses should set clear learning objectives for cognitive skills they expect students to acquire. Thus, professionals in different fields will be enabled to improve environmental decision-making processes and to participate effectively in multidisciplinary work groups charged with tackling environmental issues.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this paper we present a study of reading comprehension based on a contrastive argumentative-discursive approach. We examine the relationship between linguistic materiality and discursive processes, observing the connection between reading in a foreign language, writing production and textual memories in the mother tongue. In addition to an interest in practical language teaching and learning processes (in this case of Spanish and Portuguese), we investigate the question of politeness and the theoretical relationship between subjectivity, language, and textuality. The latter, being understood as the result of discourse regularities, is unique for each and every production, yet is also conditioned by plural discursive memories resulting from contradictory social relationships in a specific historical context (Foucault, 1986; Pêcheux, 1990). In the experiment presented here, we follow some of the procedures of the methodology applied in the European Galatea Project developed for the study of reading strategies in the inter-comprehension between Romance languages (Dabène, 1996). We use the procedure of simulation and the subjective projection of participants as well as the notion of discursive resonance in the analysis. The results, having to do with directness and indirectness in speech and the question of politeness in two typologically close languages, lead to the conclusion that the concept of politeness goes beyond a pragmatic strategy used to avoid conflicts to be approached as a marker of cultural identity constitution. The relevance of discursive awareness and its theoretical and practical consequences are then emphasized.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper reports some exemplary data related to a research project on the role of translation in foreign language teaching-learning. The data were collected through a questionnaire administered to 47 Brazilian ESL learners. Specifically, the points of the analysis are: how the translation process is conceived by the students; why and when the translation is used by the learners in classroom situations; mother tongue/foreign language relationships in this specific context, among other aspects. The findings reveal that translation, when used a mediating resource for foreign language teaching-learning, can promote target language management.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.