27 resultados para Resistividade de corpos
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
This work was done with the objective of studying some physical and mechanical characteristics of the sugarcane bagasse ash added to a soil-cement mixture, in order to obtain an alternative construction material. The sugarcane bagasse ash pre-treatment included both sieving and grinding, before mixing with soil and cement. Different proportions of cement-ash were tested by determining its standard consistence and its compressive resistance at 7 and 28 days age. The various treatments were subsequently applied to the specimens molded with different soil-cement-ash mixtures which in turns were submitted to compaction, unconfined compression and water absorption laboratory tests. The results showed that it is possible to replace up to 20% of Portland cement by sugarcane bagasse ash without any damage to the mixture's compressive strength.
Resumo:
Cardboard packing for horticultural products has as main function to protect them. The design of a cardboard packing request the knowledge of the bending stiffens which is depending on the modulus of elasticity. The objective of this work was to calculate the cardboard modulus of elasticity from data obtained in laboratory using physical characterization test, with different methods, and comparing the results with the values obtained experimentally. Ten samples of each cardboard selected for this study were tested in the paper fabrication direction and in its transverse direction. The papers liner and medium resistance to the traction, used to calculate the bending stiffness, was determined in a universal machine test. To obtaining of the bending stiffens the four points test was accomplished. Expressive variations among the methods from which the modulus of elasticity is obtained were observed and that influence the bending stiffness of the structure. The stiffness values obtained experimentally were always greater than the values obtained from analytical method. This difference can be attributed to two factors, the production processes that assurance a larger rigidity than the components separately and the addition of the adhesive layer that is not taken in consideration in the analytic calculations.
Resumo:
The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.
Resumo:
Rice husk, employed as an energy source at milling industries in Brazil generates, after burning, a dark ash. This residue is not yet conveniently disposed, being currently dumped on large areas, causing environmental problems. This research intended to evaluate the applications of residual rice husk ashes (RHA) as a partial replacement of cement for mortar production. Rice husk ash was chemically characterized through X-ray fluorescence, determination of carbon content, X-ray diffraction, and laser granulometric analysis. Mortar specimens were submitted to two different exposure conditions: internal and external environments at a maximum period of five months. Physical-mechanical testing were compressive strength and ultrasonic pulse velocity (UPV). Although presenting good mechanical performance, the mortar based on ash (RHA) did not present pozolanicity but it can be employed in cement matrices as inert material (filler).
Resumo:
Annatto seeds do not germinate during early stages of their development because of insufficient reserve substances. In situ analysis showed that the principal reserves are proteins and starch, deposited in endosperm cells. During the early stages of development, the starch grains were elliptic, because amylose was the minor component. During development, these grains became more spherical due to an increase in amylose relative to amylopectin. Endosperm cells do not contain protein bodies, but they accumulate proteins dispersed in the cytoplasm. At the final stage of development the proteins became compacted due to the dehydration of the seeds wich is part of the global process of orthodox seeds maturation. Natural fluorescence revealed aromatic amino acids, principally tryptophan and tyrosine in the proteins. The seeds reached their maximum dry weight after moisture contents had declined to around 60%. At this point the seeds presented maximum germination capacity.
Resumo:
This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.
Resumo:
The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física