16 resultados para Reflective light microscopy
Resumo:
Snakebite is a neglected disease and serious health problem in Brazil, with most bites being caused by snakes of the genus Bothrops. Although serum therapy is the primary treatment for systemic envenomation, it is generally ineffective in neutralizing the local effects of these venoms. In this work, we examined the ability of 7,8,3'-trihydroxy-4'-methoxyisoflavone (TM), an isoflavone from Dipteryx alata, to neutralize the neurotoxicity (in mouse phrenic nerve-diaphragm preparations) and myotoxicity (assessed by light microscopy) of Bothrops jararacussu snake venom in vitro. The toxicity of TM was assessed using the Salmonella microsome assay (Ames test). Incubation with TM alone (200 μg/mL) did not alter the muscle twitch tension whereas incubation with venom (40 μg/mL) caused irreversible paralysis. Preincubation of TM (200 μg/mL) with venom attenuated the venom-induced neuromuscular blockade by 84% ± 5% (mean ± SEM; n = 4). The neuromuscular blockade caused by bothropstoxin-I (BthTX-I), the major myotoxic PLA2 of this venom, was also attenuated by TM. Histological analysis of diaphragm muscle incubated with TM showed that most fibers were preserved (only 9.2% ± 1.7% were damaged; n = 4) compared to venom alone (50.3% ± 5.4% of fibers damaged; n = 3), and preincubation of TM with venom significantly attenuated the venom-induced damage (only 17% ± 3.4% of fibers damaged; n = 3; p < 0.05 compared to venom alone). TM showed no mutagenicity in the Ames test using Salmonella strains TA98 and TA97a with (+S9) and without (-S9) metabolic activation. These findings indicate that TM is a potentially useful compound for antagonizing the neuromuscular effects (neurotoxicity and myotoxicity) of B. jararacussu venom.
Resumo:
Facial cosmetic procedures are increasingly requested, and dermal filler materials have been widely used as a nonsurgical option since the 1980s. However, injectable fillers have been implicated in local adverse reactions. Therefore, the aim of this article was to describe the use of fine needle aspiration cytology (FNAC) in the diagnosis of foreign-body reactions to the perioral injection of dermal fillers. A 69-year-old woman presented with a painful nodule on her right nasolabial fold. Intraoral FNAC was performed, and cytologic smears were examined under optical and polarized light microscopy, showing birefringent microspheres, confirming the diagnosis of an adverse reaction caused by polymethyl methacrylate filler. FNAC is a less invasive method to confirm the diagnosis of adverse reactions caused by perioral cosmetic dermal fillers.
Resumo:
It is well known that trichomes protect plant organs, and several studies have investigated their role in the adaptation of plants to harsh environments. Recent studies have shown that the production of hydrophilic substances by glandular trichomes and the deposition of this secretion on young organs may facilitate water retention, thus preventing desiccation and favouring organ growth until the plant develops other protective mechanisms. Lychnophora diamantinana is a species endemic to the Brazilian 'campos rupestres' (rocky fields), a region characterized by intense solar radiation and water deficits. This study sought to investigate trichomes and the origin of the substances observed on the stem apices of L. diamantinana. Samples of stem apices, young and expanded leaves were studied using standard techniques, including light microscopy and scanning and transmission electron microscopy. Histochemical tests were used to identify the major groups of metabolites present in the trichomes and the hyaline material deposited on the apices. Non-glandular trichomes and glandular trichomes were observed. The material deposited on the stem apices was hyaline, highly hydrophilic and viscous. This hyaline material primarily consists of carbohydrates that result from the partial degradation of the cell wall of uniseriate trichomes. This degradation occurs at the same time that glandular trichomes secrete terpenoids, phenolic compounds and proteins. These results suggest that the non-glandular trichomes on the leaves of L. diamantinana help protect the young organ, particularly against desiccation, by deposition of highly hydrated substances on the apices. Furthermore, the secretion of glandular trichomes probably repels herbivore and pathogen attacks.
Resumo:
Ameloblastic fibro-odontoma (AFO) is a slow-growing, expansive, benign odontogenic tumor, composed of ameloblastic epithelium embedded in an ectomesenchymal stroma resembling dental papilla, containing hard dental tissue in variable degrees of maturation, including enamel, dentin, and sometimes cementum. AFO typically affects the posterior mandible, causing bony expansion. We report a case of pigmented AFO in a 5-year-old boy, comprising clinical and histological features illustrated by immunohistochemistry using a large panel of antibodies, polarized light microscopy and scanning electron microscopy.
Resumo:
Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.
Resumo:
It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
To evaluate the influence of a fluorescent dye (rhodamine B) on the physical and mechanical properties of three different luting cements: a conventional adhesive luting cement (RelyX ARC, 3M/ESPE), a self-adhesive luting cement (RelyX U-200, 3M/ESPE), and a self-etching and self-adhesive luting cement (SeT PP, SDI). The cements were mixed with 0.03 wt% rhodamine B, formed into bar-shaped specimens (n = 10), and light cured using an LED curing unit (Radii, SDI) with a radiant exposure of 32 J/cm(2) . The Knoop hardness (KHN), flexural strength (FS), and Young's modulus (YM) analyses were evaluated after storage for 24 h. Outcomes were subjected to two-way ANOVA and Tukey's test (P = 0.05) for multiple comparisons. No significant differences in FS or YM were observed among the tested groups (P ≥ 0.05); the addition of rhodamine B increased the hardness of the luting cements tested. The addition of a fluorescent agent at 0.03 wt% concentration does not negatively affect the physical-mechanical properties of the luting cement polymerization behavior.
Resumo:
Graphene and carbon nanotube nanocomposite (GCN) was synthesised and applied in gene transfection of pIRES plasmid conjugated with green fluorescent protein (GFP) in NIH-3T3 and NG97 cell lines. The tips of the multi-walled carbon nanotubes (MWCNTs) were exfoliated by oxygen plasma etching, which is also known to attach oxygen content groups on the MWCNT surfaces, changing their hydrophobicity. The nanocomposite was characterised by high resolution scanning electron microscopy; energy-dispersive X-ray, Fourier transform infrared and Raman spectroscopies, as well as zeta potential and particle size analyses using dynamic light scattering. BET adsorption isotherms showed the GCN to have an effective surface area of 38.5m(2)/g. The GCN and pIRES plasmid conjugated with the GFP gene, forming π-stacking when dispersed in water by magnetic stirring, resulting in a helical wrap. The measured zeta potential confirmed that the plasmid was connected to the nanocomposite. The NIH-3T3 and NG97 cell lines could phagocytize this wrap. The gene transfection was characterised by fluorescent protein produced in the cells and pictured by fluorescent microscopy. Before application, we studied GCN cell viability in NIH-3T3 and NG97 line cells using both MTT and Neutral Red uptake assays. Our results suggest that GCN has moderate stability behaviour as colloid solution and has great potential as a gene carrier agent in non-viral based therapy, with low cytotoxicity and good transfection efficiency.
Resumo:
The aim of this study was to evaluate the effectiveness of 17% ethylene-diamine-tetra-acetic acid (EDTA) used alone or associated with 2% chlorhexidine gel (CHX) on intracanal medications (ICM) removal. Sixty single-rooted human teeth with fully formed apex were selected. The cervical and middle thirds of each canal were prepared with Gates Glidden drills and rotary files. The apical third was shaped with hand files. The specimens were randomly divided into two groups depending on the ICM used after instrumentation: calcium hydroxide Ca(OH)(2) +CHX or Ca(OH)(2) +sterile saline (SS). After seven days, each group was divided into subgroups according to the protocol used for ICM removal: instrumentation and irrigation either with EDTA, CHX+EDTA, or SS (control groups). All specimens were sectioned and processed for observation of the apical thirds by using scanning electron microscopy. Two calibrated evaluators attributed scores to each specimen. The differences between the protocols for ICM removal were analyzed with Kruskal-Wallis and Mann-Whitney U tests. Friedman and Wilcoxon signed rank tests were used for comparison between the score of debris obtained in each root canal third. Remains of Ca(OH)(2) were found in all specimens independently of the protocol and ICM used (P > 0.05). Seventeen percent EDTA showed the best results in removing ICM when used alone (P < 0.05), particularly in those associated with CHX. It was concluded that the chelating agent 17% EDTA significantly improved the removal of ICM when used alone. Furthermore, the type of the vehicle associated with Ca(OH)(2) also plays a role in the ICM removal.
Resumo:
Histological and histochemical observations support the hypothesis that collagen fibers can link to elastic fibers. However, the resulting organization of elastin and collagen type complexes and differences between these materials in terms of macromolecular orientation and frequencies of their chemical vibrational groups have not yet been solved. This study aimed to investigate the macromolecular organization of pure elastin, collagen type I and elastin-collagen complexes using polarized light DIC-microscopy. Additionally, differences and similarities between pure elastin and collagen bundles (CB) were investigated by Fourier transform-infrared (FT-IR) microspectroscopy. Although elastin exhibited a faint birefringence, the elastin-collagen complex aggregates formed in solution exhibited a deep birefringence and formation of an ordered-supramolecular complex typical of collagen chiral structure. The FT-IR study revealed elastin and CB peptide NH groups involved in different types of H-bonding. More energy is absorbed in the vibrational transitions corresponding to CH, CH2 and CH3 groups (probably associated with the hydrophobicity demonstrated by 8-anilino-1-naphtalene sulfonic acid sodium salt [ANS] fluorescence), and to νCN, δNH and ωCH2 groups of elastin compared to CB. It is assumed that the α-helix contribution to the pure elastin amide I profile is 46.8%, whereas that of the B-sheet is 20% and that unordered structures contribute to the remaining percentage. An FT-IR profile library reveals that the elastin signature within the 1360-1189cm(-1) spectral range resembles that of Conex-Toray aramid fibers.
Resumo:
Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.
Resumo:
The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.
Resumo:
Several medical and dental schools have described their experience in the transition from conventional to digital microscopy in the teaching of general pathology and histology disciplines; however, this transitional process has scarcely been reported in the teaching of oral pathology. Therefore, the objective of the current study is to report the transition from conventional glass slide to virtual microscopy in oral pathology teaching, a unique experience in Latin America. An Aperio ScanScope® scanner was used to digitalize histological slides used in practical lectures of oral pathology. The challenges and benefits observed by the group of Professors from the Piracicaba Dental School (Brazil) are described and a questionnaire to evaluate the students' compliance to this new methodology was applied. An improvement in the classes was described by the Professors who mainly dealt with questions related to pathological changes instead of technical problems; also, a higher interaction with the students was described. The simplicity of the software used and the high quality of the virtual slides, requiring a smaller time to identify microscopic structures, were considered important for a better teaching process. Virtual microscopy used to teach oral pathology represents a useful educational methodology, with an excellent compliance of the dental students.
Resumo:
To evaluate the influence of light-activation of second, third and fourth increments on degree of conversion (DC) and microhardness (KHN) of the top (T) and bottom (B) surface of the first increment. Forty samples (n = 5) were prepared. In groups 1-4, after each increment light-activation (multiple irradiation), T and B of the first increment were measured in DC and KHN. In groups 5-8, only the first increment was made (single irradiation) and measurements of DC and KHN were taken at 15 min intervals. The light-activation modes were (XL) 500 mW/cm(2) × 38 s (G1/G5); (S) 1000 mW/cm(2) × 19 s (G2/G6), (HP) 1400 mW/cm(2) × 14 s (G3/G7); (PE) 3200 mW/cm(2) × 6 s (G4/G8). Data for DC and KHN were analyzed separately by using PROC MIXED for repeated measures and Tukey-Kramer test (α = 0.05). For KHN, B showed lower values than T. PE resulted in lower values of KHN in B surface. For single and multiple irradiations, T and B of first measurement showed the lowest KHN and the fourth measurement showed the highest, with significant difference between them. For single irradiation, first and second increments presented similar KHN, different from the third and fourth increment, which did not differ between them. For multiple irradiations, the second light-activation resulted in KHN similar to first, third and fourth increments. For DC, except QTH, T presented higher DC than B. The light-activation of successive increments was not able to influence the KHN and DC of the first increment.