21 resultados para Microbial Control
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organisms<0.4 log CFU/cm(2)). Peracetic acid was the most effective disinfectant, eliminating the multi-species biofilms under all tested conditions (counts of the all microorganisms <0.4 log CFU/cm(2)). In contrast, biguanide was the least effective disinfectant, failing to eliminate biofilms under all the test conditions.
Resumo:
Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.
Resumo:
In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.
Resumo:
The control of energy homeostasis relies on robust neuronal circuits that regulate food intake and energy expenditure. Although the physiology of these circuits is well understood, the molecular and cellular response of this program to chronic diseases is still largely unclear. Hypothalamic inflammation has emerged as a major driver of energy homeostasis dysfunction in both obesity and anorexia. Importantly, this inflammation disrupts the action of metabolic signals promoting anabolism or supporting catabolism. In this review, we address the evidence that favors hypothalamic inflammation as a factor that resets energy homeostasis in pathological states.
Resumo:
Paraquat is a fast acting nonselective contact herbicide that is extensively used worldwide. However, the aqueous solubility and soil sorption of this compound can cause problems of toxicity in nontarget organisms. This work investigates the preparation and characterization of nanoparticles composed of chitosan and sodium tripolyphosphate (TPP) to produce an efficient herbicidal formulation that was less toxic and could be used for safer control of weeds in agriculture. The toxicities of the formulations were evaluated using cell culture viability assays and the Allium cepa chromosome aberration test. The herbicidal activity was investigated in cultivations of maize (Zea mays) and mustard (Brassica sp.), and soil sorption of the nanoencapsulated herbicide was measured. The efficiency association of paraquat with the nanoparticles was 62.6 ± 0.7%. Encapsulation of the herbicide resulted in changes in its diffusion and release as well as its sorption by soil. Cytotoxicity and genotoxicity assays showed that the nanoencapsulated herbicide was less toxic than the pure compound, indicating its potential to control weeds while at the same time reducing environmental impacts. Measurements of herbicidal activity showed that the effectiveness of paraquat was preserved after encapsulation. It was concluded that the encapsulation of paraquat in nanoparticles can provide a useful means of reducing adverse impacts on human health and the environment, and that the formulation therefore has potential for use in agriculture.
Resumo:
Biofilm formation on reverse osmosis (RO) systems represents a drawback in the application of this technology by different industries, including oil refineries. In RO systems the feed water maybe a source of microbial contamination and thus contributes for the formation of biofilm and consequent biofouling. In this study the planktonic culturable bacterial community was characterized from a feed water of a RO system and their capacities were evaluated to form biofilm in vitro. Bacterial motility and biofilm control were also analysed using phages. As results, diverse Protobacteria, Actinobacteria and Bacteroidetes were identified. Alphaproteobacteria was the predominant group and Brevundimonas, Pseudomonas and Mycobacterium the most abundant genera. Among the 30 isolates, 11 showed at least one type of motility and 11 were classified as good biofilm formers. Additionally, the influence of non-specific bacteriophage in the bacterial biofilms formed in vitro was investigated by action of phages enzymes or phage infection. The vB_AspP-UFV1 (Podoviridae) interfered in biofilm formation of most tested bacteria and may represent a good alternative in biofilm control. These findings provide important information about the bacterial community from the feed water of a RO system that may be used for the development of strategies for biofilm prevention and control in such systems.
Resumo:
The maintenance of glucose homeostasis is complex and involves, besides the secretion and action of insulin and glucagon, a hormonal and neural mechanism, regulating the rate of gastric emptying. This mechanism depends on extrinsic and intrinsic factors. Glucagon-like peptide-1 secretion regulates the speed of gastric emptying, contributing to the control of postprandial glycemia. The pharmacodynamic characteristics of various agents of this class can explain the effects more relevant in fasting or postprandial glucose, and can thus guide the individualized treatment, according to the clinical and pathophysiological features of each patient.
Resumo:
Rhodotorula glutinis CCT 2182, Rhodosporidium toruloides CCT 0783, Rhodotorula minuta CCT 1751 and Lipomyces starkeyi DSM 70296 were evaluated for the conversion of sugars from Brazilian molasses into single-cell oil (SCO) feedstock for biodiesel. Pulsed fed-batch fermentations were performed in 1.65 l working volume bioreactors. The maximum specific growth rate (µmax), lipid productivity (Pr) and cellular lipid content were, respectively, 0.23 h(-1), 0.41 g l(-1) h(-1), and 41% for Rsp. toruloides; 0.20 h(-1), 0.27 g l(-1) h(-1), and 36% for Rta. glutinis; 0.115 h(-1), 0.135 g l(-1) h(-1), and 27 % for Rta. minuta; and 0.11 h(-1), 0.13 g l(-1) h(-1), and 32% for L. starkeyi. Based on their microbial lipid productivity, content, and profile, Rsp. toruloides and Rta. glutinis are promising candidates for biodiesel production from Brazilian molasses. All the oils from the yeasts were similar to the composition of plant oils (rapeseed and soybean) and could be used as raw material for biofuels, as well as in food and nutraceutical products.
Resumo:
The objective of this study was to analyze the prevalence of diabetes in older people and the adopted control measures. Data regarding older diabetic individuals who participated in the Health Surveys conducted in the Municipality of Sao Paulo, SP, ISA-Capital, in 2003 and 2008, which were cross-sectional studies, were analyzed. Prevalences and confidence intervals were compared between 2003 and 2008, according to sociodemographic variables. The combination of the databases was performed when the confidence intervals overlapped. The Chi-square (level of significance of 5%) and the Pearson's Chi-square (Rao-Scott) tests were performed. The variables without overlap between the confidence intervals were not tested. The age of the older adults was 60-69 years. The majority were women, Caucasian, with an income of between > 0.5 and 2.5 times the minimum salary and low levels of schooling. The prevalence of diabetes was 17.6% (95%CI 14.9;20.6) in 2003 and 20.1% (95%CI 17.3;23.1) in 2008, which indicates a growth over this period (p at the limit of significance). The most prevalent measure adopted by the older adults to control diabetes was hypoglycemic agents, followed by diet. Physical activity was not frequent, despite the significant differences observed between 2003 and 2008 results. The use of public health services to control diabetes was significantly higher in older individuals with lower income and lower levels of education. Diabetes is a complex and challenging disease for patients and the health systems. Measures that encourage health promotion practices are necessary because they presented a smaller proportion than the use of hypoglycemic agents. Public health policies should be implemented, and aimed mainly at older individuals with low income and schooling levels. These changes are essential to improve the health condition of older diabetic patients.
Resumo:
A retrospective case-control study based on craniometrical evaluation was performed to evaluate the incidence of basilar invagination (BI). Patients with symptomatic tonsillar herniation treated surgically had craniometrical parameters evaluated based on CT scan reconstructions before surgery. BI was diagnosed when the tip of the odontoid trespassed the Chamberlain's line in three different thresholds found in the literature: 2, 5 or 6.6 mm. In the surgical group (SU), the mean distance of the tip of the odontoid process above the Chamberlain's line was 12 mm versus 1.2 mm in the control (CO) group (p<0.0001). The number of patients with BI according to the threshold used (2, 5 or 6.6 mm) in the SU group was respectively 19 (95%), 16 (80%) and 15 (75%) and in the CO group it was 15 (37%), 4 (10%) and 2 (5%).
Resumo:
83
Resumo:
This work addresses the development and characterization of porous chitosan-alginate based polyelectrolyte complexes, obtained by using two different proportions of the biocompatible surfactant Pluronic F68. These biomaterials are proposed for applications as biodegradable and biocompatible wound dressing and/or scaffolds. The results indicate that thickness, roughness, porosity and liquid uptake of the membranes increase with the amount of surfactant used, while their mechanical properties and stability in aqueous media decrease. Other important properties such as color and surface hydrophilicity (water contact angle) are not significantly altered or did not present a clear tendency of variation with the increase of the amount of surfactant added to the polyelectrolyte complexes, such as real density, average pore diameter, total pore volume and surface area. The prepared biomaterials were not cytotoxic to L929 cells. In conclusion, it is possible to tune the physicochemical properties of chitosan-alginate polyelectrolyte complexes, through the variation of the proportion of surfactant (Pluronic F68) added to the mixture, so as to enable the desired application of these biomaterials.
Resumo:
By comparing the SEED and Pfam functional profiles of metagenomes of two Brazilian coral species with 29 datasets that are publicly available, we were able to identify some functions, such as protein secretion systems, that are overrepresented in the metagenomes of corals and may play a role in the establishment and maintenance of bacteria-coral associations. However, only a small percentage of the reads of these metagenomes could be annotated by these reference databases, which may lead to a strong bias in the comparative studies. For this reason, we have searched for identical sequences (99% of nucleotide identity) among these metagenomes in order to perform a reference-independent comparative analysis, and we were able to identify groups of microbial communities that may be under similar selective pressures. The identification of sequences shared among the metagenomes was found to be even better for the identification of groups of communities with similar niche requirements than the traditional analysis of functional profiles. This approach is not only helpful for the investigation of similarities between microbial communities with high proportion of unknown reads, but also enables an indirect overview of gene exchange between communities.
Resumo:
To characterize the recently described SCI1 (stigma/style cell cycle inhibitor 1) gene relationship with the auxin pathway, we have taken the advantage of the Arabidopsis model system and its available tools. At first, we have analyzed the At1g79200 T-DNA insertion mutants and constructed various transgenic plants. The loss- and gain-of-function plants displayed cell number alterations in upper pistils that were controlled by the amino-terminal domain of the protein. These data also confirmed that this locus holds the functional homolog (AtSCI1) of the Nicotiana tabacum SCI1 gene. Then, we have provided some evidences the auxin synthesis/signaling pathways are required for downstream proper AtSCI1 control of cell number: (a) its expression is downregulated in yuc2yuc6 and npy1 auxin-deficient mutants, (b) triple (yuc2yuc6sci1) and double (npy1sci1) mutants mimicked the auxin-deficient phenotypes, with no synergistic interactions, and (c) the increased upper pistil phenotype in these last mutants, which is a consequence of an increased cell number, was able to be complemented by AtSCI1 overexpression. Taken together, our data strongly suggests SCI1 as a component of the auxin signaling transduction pathway to control cell proliferation/differentiation in stigma/style, representing a molecular effector of this hormone on pistil development.