16 resultados para Histologia comparada
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
CONTEXT: Intestinal constipation - a common symptom among the general population - is more frequent in women. It may be secondary to an improper diet or organic or functional disturbances, such as dyskinesia of the pelvic floor. This is basically characterized by the absence of relaxation or paradoxical contraction of the pelvic floor and anal sphincter during evacuation. OBJECTIVE: To analyze, by manometric data, the anal pressure variation at rest, during evacuation effort by using the Valsalva maneuver and forced post-expiratory apnea in subjects with secondary constipation. METHODS: Twenty-one patients (19 females - 90.4%) with a mean age of 47.5 years old (23-72) were studied. The diagnosis was performed using anorectal manometry, with a catheter containing eight channels disposed at the axial axis, measuring the proximal (1) and distal (2) portions of the anal orifice. The elevation of the pressure values in relation to the resting with the evacuation effort was present in all patients. The Agachan score was used for clinical evaluation of constipation. The variables studied were: mean anal pressure of the anal orifice for 20 seconds at rest, the effort of evacuation using Valsalva maneuver and the effort of evacuation during apnea after forced expiration, as well as the area under the curve of the manometric tracing at moments Valsalva and apnea. RESULTS: The analysis of the mean values of the anal pressure variation at rest evidenced difference between proximal and distal channels (P = 0.007), independent of the moment and tendency to differ during moments Valsalva and apnea (P = 0.06). The mean of values of the area under the manometric tracing curve showed differences between moments Valsalva and apnea (P = 0.0008), either at the proximal portion or at the distal portion of the anal orifice. CONCLUSION: The effort of evacuation associated with postexpiratory apnea, when compared with the effort associated with the Valsalva maneuver, provides lower elevation of anal pressure at rest by the parameter area under the curve.
Resumo:
Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.
Resumo:
Air quality in animal production environment has been refereed as an interesting point for studies in environmental control systems with the focus both to the animal health which live in total confinement, as to the workers. The objective of this research was to determine the variation on the aerial environmental quality in two types of broiler housing: conventional (Gc) and tunnel type (Gt). The total dust values in both houses offered adequate rearing conditions to the birds; however, regarding the inhale dust in the air was above the limits recommended for humans. Carbon monoxide concentration in the heating phase during the evaluated period was above the 10 ppm maximum recommended, and it was higher during the cold season in Gt house (30 ppm) when compared to the Gc house (18 ppm). Ammonia concentration peaks in the air were above the 20 ppm recommended from the 20th day of production in both houses and in daily average, for a period higher in Gt (4h30) when compared to Gt (2h45). Only traces of nitrate oxide and methane were found while carbonic dioxide gas concentration evaluated during daytime met the limits allowed for both birds and labor.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To verify if the frequency of spontaneous pubertal development among girls with Turner syndrome (TS) diagnosed in infancy and childhood is greater than that of patients diagnosed later. SUBJECTS AND METHODS: Thirty three girls aged < 10 years at the time of diagnosis were evaluated regarding pubertal development. The frequency of spontaneous puberty was compared with that of girls aged > 13 years diagnosed at the same service. RESULTS: Sixteen of 32 informative patients had signs of spontaneous puberty, a frequency greater than that of patients diagnosed later. In six patients, there was no progression of puberty; menarche occurred in six, and one became pregnant, but the fetus was a stillborn. Spontaneous puberty was absent in all cases with 45,X karyotype. CONCLUSIONS: The greater prevalence of spontaneous puberty in girls whose diagnosis was not based on pubertal delay suggests that, among those diagnosed later, there is a bias towards patients with hypogonadism. Arq Bras Endocrinol Metab. 2012;56(9):653-7
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas. Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física