27 resultados para Controle bibliográfico nacional
Resumo:
The individual affective-cognitive evaluations are important factors that control the way he feels the disease impact in his life. Then, the perception of seizure control is a more important factor to evaluate Quality of Life (QoL) than the illness characteristics, such as the severity, type, sickening period and seizure frequency. This study searched for the relationship among the subjective variables (perception of seizure control) and the illness characteristics to evaluate QoL. The sample consisted of 60 individuals with chronic epilepsy, aging 18 to 70 (M=37.05; SD=11.25), chosen at randon from the ambulatory of epilepsy - HC/UNICAMP, by the Questionnaire 65. The illness characteristics were not significant, except the seizures frequency, when associated to the impairment in QoL among controlled seizures and seizures with frequency higher than 10 per month (p=0.021). The perception of control was significantly associated to QoL (p=0.005).
Resumo:
An alternative proposal for floor heating system by means of electric resistance for both chick and piggy installation is presented in this work. Several formulations of rice husk and cement mortar boards were used. An electronic device controlled all board temperature. This system presented a good efficiency design. The conventional cement mortar mixed with rice husk showed a better performance.
Resumo:
One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.
Resumo:
The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.
Resumo:
This study presents the results of a cost-effectiveness analysis in a controlled clinical trial on the effectiveness of a modified glass ionomer resin sealant ( Vitremer, 3M ESPE) and the application of fluoride varnish (Duraphat, Colgate) on occlusal surfaces of first permanent molars in children 6-8 years of age (N = 268), according to caries risk (high versus low). Children were examined semiannually by the same calibrated dentist for 24 months after allocation in six groups: high and low risk controls (oral health education every three months); high and low risk with varnish (oral health education every three months + varnish biannually); and high and low risk with sealant (oral health education every three months + a single application of sealant). Economic analysis showed that sealing permanent first molars of high-risk schoolchildren showed a C/E ratio of US$ 119.80 per saved occlusal surface and an incremental C/E ratio of US$ 108.36 per additional saved occlusal surface. The study concluded that sealing permanent first molars of high-risk schoolchildren was the most cost-effective intervention.
Resumo:
The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.
Resumo:
This text which discusses the central theme of the National Conference on Education (CONAE), held in Brasília from 28th March to 1st April 2010, deals with the concept of a National System of Education in articulation with the National Plan of Education. To that end, after pointing to the basic uses of the concept of system, it discusses the question of the National System of Education exploring the federative question in order to reveal the complete compatibility of the organization of the National System of Education with the federative regime. Thereafter, it deals with the historical meaning of the National Plan of Education demonstrating that the plan is a demand of the system, since planned action is implicit in systematized education. Thus the National Plan of Education is fulfilling those goals and objectives for which it is responsible.
Resumo:
The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.
Resumo:
The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Childrens Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This study analyses the national scientific production about college students' residence halls. The country's main data bases and electronic sites of several Brazilian higher education institutions were checked and 23 studies, published between 2000 and 2009, were found. The results of our analysis point to different focuses, which can be grouped into three categories: students who live in residence halls, residence halls themselves and actions for student assistance. Although there is large foreign scientific production about college student housing, the national production on this theme is still scarce, and the idea of student residence halls as educational spaces is still very incipient. The study points out to the need for investigating the living conditions in these places, and the impacts of this kind of habitation on students. Considering that student housing is an institutional responsibility, these studies potentially subsidize measures for proper educational conditions for college students.
Resumo:
PURPOSE: To evaluate the ocular surface toxicity of two nitric oxide donors in ex vivo and in vivo animal models: S-nitrosoglutathione (GSNO) and S-nitroso-N-acetylcysteine (SNAC) in a hydroxypropyl methylcellulose (HPMC) matrix at final concentrations 1.0 and 10.0 mM. METHODS: Ex vivo GSNO and SNAC toxicities were clinically and histologically analyzed using freshly excised pig eyeballs. In vivo experiments were performed with 20 albino rabbits which were randomized into 4 groups (5 animals each): Groups 1 and 2 received instillations of 150 µL of aqueous HPMC solution containing GSNO 1.0 and 10.0 mM, respectively, in one of the eyes; Groups 3 and 4 received instillations of 150 µL of aqueous HPMC solution-containing SNAC 1.0 and 10.0 mM, respectively, in one of the eyes. The contralateral eyes in each group received aqueous HPMC as a control. All animals underwent clinical evaluation on a slit lamp and the eyes were scored according to a modified Draize eye test and were histologically analyzed. RESULTS: Pig eyeballs showed no signs of perforation, erosion, corneal opacity or other gross damage. These findings were confirmed by histological analysis. There was no difference between control and treated rabbit eyes according to the Draize eye test score in all groups (p>0.05). All formulations showed a mean score under 1 and were classified as non-irritating. There was no evidence of tissue toxicity in the histological analysis in all animals. CONCLUSION: Aqueous HPMC solutions containing GSNO and SNAC at concentrations up to 10.0 mM do not induce ocular irritation.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física